Transcriptomics

Dataset Information

0

Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation


ABSTRACT: Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).

ORGANISM(S): Homo sapiens

PROVIDER: GSE51441 | GEO | 2014/07/22

SECONDARY ACCESSION(S): PRJNA223175

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2014-07-22 | E-GEOD-51441 | biostudies-arrayexpress
2007-12-01 | GSE8945 | GEO
2014-02-19 | E-GEOD-55129 | biostudies-arrayexpress
2011-10-01 | GSE28072 | GEO
2014-07-30 | GSE59897 | GEO
2012-11-22 | GSE34170 | GEO
2013-11-15 | E-MEXP-3869 | biostudies-arrayexpress
2012-11-22 | E-GEOD-34170 | biostudies-arrayexpress
2016-08-17 | GSE85684 | GEO
2011-06-04 | GSE29743 | GEO