ICLIP of DDX3X and DDX54 in human MCF7 cells
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB23553 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Individual nucleotide resolution cross-linking immunoprecipitation (iCLIP) detects protein-RNA binding sites at a single nucleotide resolution. We aimed to identify the transcripts directly bound to DDX3X and DDX54 in human breast cancer MCF7 cells and to characterize the site of interaction at a single nucleotide resolution.
2018-11-21 | E-MTAB-6230 | biostudies-arrayexpress
Project description:We performed RNA-seq to observe the gene expression changes in cells following siRNA-mediated knockdown of DDX3X and DDX54 RNA helicases in human breast cancer MCF7 cells. Two siRNAs were used to target each RNA helicase and scramble siRNA-treated MCF7 cells were used as controls.
2018-11-21 | E-MTAB-6235 | biostudies-arrayexpress
Project description:We aimed to investigate the chromatin binding activity of DDX3X and DDX54 RNA helicases in human ER -dependent breast cancer MCF7 cells. We run a parallel chromatin binding profiling of ER ChIP-seq. H3K4me3 profiling was used as a quality control of the ChIP-seq procedure.
2019-11-14 | E-MTAB-6211 | biostudies-arrayexpress
Project description:ChIPseq of DDX3X, DDX54, ER and H3K4me3 in human MCF7 cells
| PRJEB23458 | ENA
Project description:Expression profiling of DDX3X and DDX54 knockdown in MCF7 cells
| PRJEB23554 | ENA
Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.
2023-03-31 | GSE201967 | GEO
Project description:Accumulating evidence has shown that cellular double-stranded RNAs (dsRNAs) induce antiviral innate immune responses in human normal and malignant cancer cells. However, it is not fully understood how endogenous ‘self’ dsRNA homeostasis is regulated in the cell. Here, we show that an RNA-binding protein, DEAD-box RNA helicase 3X (DDX3X), prevents the aberrant accumulation of cellular dsRNAs. Loss of DDX3X induces dsRNA sensor-mediated type I interferon signaling and innate immune response in breast cancer cells due to abnormal cytoplasmic accumulation of dsRNAs. Dual depletion of DDX3X and a dsRNA-editing protein, ADAR1 synergistically activates the cytosolic dsRNA pathway in breast cancer cell. Moreover, inhibiting DDX3X enhances the antitumor activity by increasing tumor intrinsic-type I interferon response, antigen presentation, and tumor-infiltration of cytotoxic T cells as well as dendritic cells in breast tumors, which may lead to the development of breast cancer therapy by targeting DDX3X in combination with immune checkpoint blockade. To assess the impact of DDX3X on the gene expression in the breast cancer, we stably depleted DDX3X in breast cancer MCF7 cells using a short hairpin RNA (shRNA)-mediated knockdown, and performed a genome-wide transcriptome analysis using a next-generation RNA deep sequencing.
2020-09-03 | GSE157323 | GEO
Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.
2022-04-06 | GSE190507 | GEO
Project description:These are the results of the iCLIP experiment for p62/SQSTM1 in Human Huh-7 cells treated with DMSO. We used iCLIP method to identify the RNA targets of p62 and nucleotide positions of the p62 interaction on RNA. We used 2 replicates and 2 different antibodies against endogenous p62 to enrich protein/RNA complexes. cDNAs were tagged with iCLIP composite barcodes (e.g. NNNTTGTNN) which contain 4 sample-encoding bases (e.g. TTGT) and and 5 random bases (noted with N in NNNTTGTNN example) which serve as unique molecular identifiers to post-filter PCR duplicates. These composite barcodes are found in the read headers (after last colon ':' character) of submitted fastq files.
2018-03-31 | E-MTAB-4894 | biostudies-arrayexpress
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59095 | GEO