Project description:Efforts to advance RNA aptamers as a novel therapeutic modality have been limited by their susceptibilty to degradation and immunogenicity. In a previous study, we demonstrated synthesized double-stranded circular RNAs (ds-cRNAs) with minimal immunogenicity targeted to dsRNA-activated Protein Kinase R (PKR). Here, we test the therapeutic potential of ds-cRNAs in a mouse model of imiquimod-induced psoriasis. We find that genetic supplementation of ds-cRNAs leads to inhibition of PKR, resulting in alleviation of downstream interferon alpha (IFNα)/dsRNA signals and attenuation of psoriasis phenotypes. Delivery of ds-cRNAs by lipid nanoparticles to the spleen attenuates PKR activity in examined splenocytes, resulting in reduced epidermal thickness. These findings suggest that ds-cRNAs represent a promising approach to mitigate excessive PKR activation for therapeutic purposes.
Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
Project description:We identified the target genes of FTO ("fat mass and obesity associated") in primary cultures of human skeletal muscle cells using adenoviral vectors expressing FTO or GFP and oligonucleotide microarrays.
Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.
Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.
Project description:RNAs are well-suited to act as cellular sensors that detect and respond to metabolite changes in the environment due to their ability to fold into complex structures. Here, we introduce a genome-wide strategy called PARCEL that experimentally identifies RNA aptamers in vitro, in a high-throughput manner. By applying PARCEL to a collection of prokaryotic and eukaryotic organisms, we have revealed 58 new RNA aptamers to three key metabolites, greatly expanding the list of natural RNA aptamers. The newly identified RNA aptamers exhibit significant sequence conservation, are highly structured and show an unexpected prevalence in coding regions. We identified a prokaryotic precursor tmRNA that acts as a vitamin B2 (FMN) binder to facilitate its maturation, as well as new coding-region eukaryotic riboswitches that bind and respond to FMN, highlighting FMN as a second class of eukaryotic riboswitches. PARCEL results show that RNA-based sensing and gene regulation is more widespread than previously appreciated in different organisms.
Project description:Fetal myogenesis and postnatal skeletal muscle hypertrophy in growing pigs are critical yet poorly understood processes. Global gene expression analyses will increase understanding of these processes by identifying key genes and pathways controlling skeletal muscle development. For this study, a pig 70-mer oligonucleotide microarray was used to identify differentially expressed genes in hind limb skeletal muscle of pigs at 60 days of gestation and 7 weeks of age. This oligonucleotide microarray experiment revealed 162 genes that were differentially expressed between 60 day fetal and 7 week postnatal samples. Relative real-time RT-PCR was used to confirm differential expression of three genes. This experiment identified genes exhibiting different developmental patterns of gene expression in pig skeletal muscle. Keywords: developmental study