Human fecal samples
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB39539 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:A metaproteomics analysis was conducted on the infant fecal microbiome to characterize global protein expression in 8 samples obtained from infants with a range of early-life experiences. Samples included breast-, formula- or mixed-fed, mode of delivery, and antibiotic treatment and one set of monozygotic twins. Although label-free mass spectrometry-based proteomics is routinely used for the identification and quantification of thousands of proteins in complex samples, the metaproteomic analysis of the gut microbiome presents particular technical challenges. Among them: the extreme complexity and dynamic range of member taxa/species, the need for matched, well-annotated metagenomics databases, and the high inter-protein sequence redundancy/similarity between related members. In this study, a metaproteomic approach was developed for assessment of the biological phenotype and functioning, as a complement to 16S rRNA sequencing analysis to identify constituent taxa. A sample preparation method was developed for recovery and lysis of bacterial cells, followed by trypsin digestion, and pre-fractionation using Strong Cation Exchange chromatography. Samples were then subjected to high performance LC-MS/MS. Data was searched against the Human Microbiome Project database, and a homology-based meta-clustering strategy was used to combine peptides from multiple species into representative proteins. Bacterial taxonomies were also identified, based on species-specific protein sequences, and protein metaclusters were assigned to pathways and functional groups. The results obtained demonstrate the applicability of this approach for performing qualitative comparisons of human fecal microbiome composition, physiology and metabolism, and also provided a more detailed assessment of microbial composition in comparison to 16S rRNA.
2019-03-29 | PXD006033 | Pride
Project description:Microbial RNAseq analysis of cecal and fecal samples collected from mice colonized with the microbiota of human twins discordant for obesity. Samples were colleted at the time of sacrifice, or 15 days after colonization from mice gavaged with uncultured or cultured fecal microbiota from the lean twins or their obese co-twins. Samples were sequenced using Illumina HiSeq technology, with 101 paired end chemistry.
2013-10-01 | GSE48861 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:We found that mainstream cigarette smoking (4 cigarettes/day, 5 days/week for 2 weeks using Kentucky Research Cigarettes 3R4F) resulted in >20% decrease in the percentage of normal Paneth cell population in Atg16l1 T300A mice but showed minimal effect in wildtype littermate control mice, indicating that Atg16l1 T300A polymorphism confers sensitivity to cigarette smoking-induced Paneth cell damage. We performed 16S rRNA sequencing to identify potential microbiota changes associated with Paneth cell defect in Atg16l1 T300A mice exposed to cigarette smoking. Female mice were used at 4-5 weeks of age. Cigarette smoking was performed using smoking chamber with the dosage and schedule as described above. The fecal samples from the mice were collected for 16S rRNA sequencing analysis after completing 6 weeks of smoking.
2018-10-31 | E-MTAB-5717 | biostudies-arrayexpress
Project description:human fecal samples Metagenome Metagenome
| PRJNA539905 | ENA
Project description:Microbial RNAseq analysis of cecal and fecal samples collected from mice colonized with the microbiota of human twins discordant for obesity. Samples were colleted at the time of sacrifice, or 15 days after colonization from mice gavaged with uncultured or cultured fecal microbiota from the lean twins or their obese co-twins. Samples were sequenced using Illumina HiSeq technology, with 101 paired end chemistry. Comparisson of microbial gene expression between the microbiota of lean and obese twins fed a Low fat, rich in plant polysaccharide diet.
2013-10-01 | E-GEOD-48861 | biostudies-arrayexpress