Oryza sativa
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA136743 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682.
2009-06-08 | GSE16248 | GEO
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing. Totally three sets of small RNAs, which were obtained under normal condition as well as salt and drought stress conditions
2008-12-08 | E-GEOD-12317 | biostudies-arrayexpress
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing.
2008-12-08 | GSE12317 | GEO
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:To identify novel miRNA and NAT-siRNAs that are associated with abiotic stresses in rice, we generated small RNA sequences from inflorescences from rice under control and under dought, salt, and cold stress treatments. Over 30 million reads were generated. sequencing of small RNAs in rice under control, drought, salt, and cold stress conditions.
2012-03-12 | E-GEOD-26357 | biostudies-arrayexpress
Project description:Genome-wide analysis for rice small RNAs by MPSS
| PRJNA107871 | ENA
Project description:Genome-wide profiling of small RNAs in Arabidopsis under abiotic stresses
| PRJNA136741 | ENA
Project description:Abiotic environmental stresses cause serious economic losses in agriculture. These stresses include temperature extremes, high salinity and drought. To isolate drought-responsive novel coding and noncoding genes, we used the next generation sequencing method from three rice cultivars (wild type nipponbare, nipponbare AP2 transgenic plants, wild type vandana). 36 NGS data of mRNA-seq, small RNA-seq, riboZero-seq were analyzed. For the analyses of these data we constructed a TF-TG (Transcription Factor-Target Gene) network and an ap2 rooted cascading tree. Using these networks and tress we isolated lincRNAs, differentially expressed miRNAs and their targets. We identified several drought stress-related novel/function unknown coding transcripts (transcription factors and functional genes) and non-coding transcripts (small noncoding transcripts such as microRNA and long noncoding transcripts) from these database analyses and have constructed databases of drought stress-related coding and noncoding transcripts Identification of drought-responsive Regulatory Coding and Non-coding Transcripts from rice by deep RNA sequencing
2016-09-06 | E-GEOD-74465 | biostudies-arrayexpress
Project description:Abiotic environmental stresses cause serious economic losses in agriculture. These stresses include temperature extremes, high salinity and drought. To isolate drought-responsive novel coding and noncoding genes, we used the next generation sequencing method from three rice cultivars (wild type nipponbare, nipponbare AP2 transgenic plants, wild type vandana). 36 NGS data of mRNA-seq, small RNA-seq, riboZero-seq were analyzed. For the analyses of these data we constructed a TF-TG (Transcription Factor-Target Gene) network and an ap2 rooted cascading tree. Using these networks and tress we isolated lincRNAs, differentially expressed miRNAs and their targets. We identified several drought stress-related novel/function unknown coding transcripts (transcription factors and functional genes) and non-coding transcripts (small noncoding transcripts such as microRNA and long noncoding transcripts) from these database analyses and have constructed databases of drought stress-related coding and noncoding transcripts
2016-09-06 | GSE74465 | GEO