Ontology highlight
ABSTRACT:
PROVIDER: PRJNA245467 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Interventions: Case vs control:No
Primary outcome(s): High-throughput sequencing
Study Design: Case-Control study
| 2676067 | ecrin-mdr-crc
Project description:Genotyping of RpoD mutants via amplicon sequencing from the following manuscript: \\"Systematic dissection of σ70 sequence diversity and function in bacteria\\" by Park and Wang (2020). Includes raw sequencing reads from samples from MAGE-seq single codon saturation mutagenesis and high-throughput fitness competition experiment as well as the RpoD ortholog mutants generated through recombineering and CRISPR selection.
2022-06-06 | E-MTAB-9103 | biostudies-arrayexpress
Project description:DNA methylation at a gene promoter region has the potential to regulate gene transcription. Their patterns are often complex with the region showing multiple allelic patterns in a sample. This complexity is commonly obscured when DNA methylation data is summarised as an average percentage value for each CpG site (or aggregated across CpG sites). The methylation state at adjacent CpG sites is therefore lost when data is summarised this way. Methylation patterns can only be characterised by clonal analysis. Deep sequencing provides the ability to investigate clonal DNA methylation patterns in unprecedented detail and scale, enabling the proper characterisation of the heterogeneity of methylation patterns. However, the sheer amount of sequencing data requires new synoptic approaches to visualise the distribution of allelic patterns. We have developed an analysis and visualisation software tool "Methpat", that extracts and displays clonal DNA methylation patterns from massively parallel sequencing data aligned using Bismark. We have performed multiplex bisulfite amplicon sequencing on a range of CpG island targets across a panel of human cell lines and primary tissues. Using Methpat, we demonstrate clonal diversity of epialleles analysed at specific gene promoter regions. We also describe the existence of DNA methylation within the mitochondrial genome. Multiplex bisulfite PCR and Next Generation sequencing of 35 samples
2015-11-23 | E-GEOD-67856 | biostudies-arrayexpress
Project description:Practical innovations for high-throughput amplicon sequencing
| PRJEB4224 | ENA
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:A comparative assessment between both technologies, RNASeq and microarrays to detect differential expression in Arabidopsis transcriptome. The sequencing approach use High-throughput sequencing on different Solexa technologies (GAII,HiSeq2000 multiplex or not) Wild type samples were analyzed from 2 tissus (flower buds and leaves) which have a very contrasted transcriptomic profile (i.e very high number of genes differentially expressed).
2014-06-01 | GSE53673 | GEO
Project description:Contaminated aquifer (Dusseldorf-Flinger, Germany) templates extracted from 5 sediment depths ranging between 6.4 and 8.4 m below ground and over 3 years of sampling were amplified for amplicon pyrosequencing using the primers Ba27f (5’-aga gtt tga tcm tgg ctc ag-3’) and Ba519r (5’- tat tac cgc ggc kgc tg-3’), extended as amplicon fusion primers with respective primer A or B adapters, key sequence and multiplex identifiers (MID) as recommended by 454/Roche. Amplicons were purified and pooled as specified by the manufacturer. Emulsion PCR (emPCR), purification of DNA-enriched beads and sequencing run were performed following protocols and using a 2nd generation pyrosequencer (454 GS FLX Titanium, Roche) as recommended by the developer. Quality filtering of the pyrosequencing reads was performed using the automatic amplicon pipeline of the GS Run Processor (Roche), with a slight modification concerning the valley filter (vfScanAllFlows false instead of TiOnly) to extract the sequences. Demultiplexed raw reads were furhter trimmed for quality and lenght (>250 bp).
2012-11-11 | GSE25345 | GEO
Project description:A comparative assessment between both technologies, RNASeq and microarrays to detect differential expression in Arabidopsis transcriptome. The sequencing approach use High-throughput sequencing on different Solexa technologies (GAII,HiSeq2000 multiplex or not) Wild type samples were analyzed from 2 tissus (flower buds and leaves) which have a very contrasted transcriptomic profile (i.e very high number of genes differentially expressed). The RNA was extracted from 2 tissus Flower Buds and Leaves from Arabidopsis. The associated GEO series with array part is GSE45345
2014-06-01 | E-GEOD-53673 | biostudies-arrayexpress
Project description:Interventions: left hemicolectomy:None;right hemicolectomy:None;sigmoid resection:None;radical rectal cancer:None;low rectal resection with prophylactic ileostomy:None
Primary outcome(s): Fecal high-throughput sequencing;Fecal Metabolomics;immunomics
Study Design: Factorial
| 85716 | ecrin-mdr-crc