Mus musculus
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA292490 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Recently, cancer immunotherapy has been paid much attention because of its improved efficacy and low frequency of adverse effects. A mouse breast cancer cell line, 4T1, has been known as poorly immunogeneic and highly metastatic cell line. In this study, we have identified a sub cell line of 4T1, designated as 4T1-Sapporo (4T1-S), which could induce a strong immune response against the same line. When 4T1-S was subcutaneously injected, striking enlargement of draining lymph nodes and increase of activated T cells were observed. The strong immune responses could not be observed when 4T1-S was injected to nude mice, indicating that this phenomenon is mediated by T cell response. Identification of 4T1-S characteristics may help to improve immunotherapy against breast cancer. 4T1-A1, 4T1-A2, 4T1-S1, 4T1-S2
2015-11-01 | E-GEOD-71926 | biostudies-arrayexpress
Project description:Recently, cancer immunotherapy has been paid much attention because of its improved efficacy and low frequency of adverse effects. A mouse breast cancer cell line, 4T1, has been known as poorly immunogeneic and highly metastatic cell line. In this study, we have identified a sub cell line of 4T1, designated as 4T1-Sapporo (4T1-S), which could induce a strong immune response against the same line. When 4T1-S was subcutaneously injected, striking enlargement of draining lymph nodes and increase of activated T cells were observed. The strong immune responses could not be observed when 4T1-S was injected to nude mice, indicating that this phenomenon is mediated by T cell response. Identification of 4T1-S characteristics may help to improve immunotherapy against breast cancer.
2015-11-01 | GSE71926 | GEO
Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.
2023-12-18 | GSE202685 | GEO
Project description:Whole Genome Sequencing of the murine breast cancer cell line 4T1 and of the murine melanoma cell line B16-ova was carried out with the aim of identifying somatic mutations. We also ran deep Mass Spectrometry proteomics analysis on the same cell lines, aiming to determine which somatic mutations carry over to the protein expression level. Further, we tested these cancer specific protein epitopes (putative neoantigens) for immunogenicity using mouse models. Finally, the putative neoantigens that showed good immunogenic potential were used in tumor growth control experiments with mice engrafted with the two tumor cell lines. In these experiments we tested whether cancer vaccines based on individual neoantigen peptides (MHC-I) restricted the growth of the tumor compared to adequate controls. The overall aim of the project is to validate the ability of our multi-omics/bioinformatics pipeline to identify and deliver neoantigens that can be used to suppress tumor growth. File names Sample names P10859_101_S1_L001_R1_001_BHKWV3CCXY 4T1_S1_L001_R1_001_BHKWV3CCXY P10859_101_S1_L001_R2_001_BHKWV3CCXY 4T1_S1_L001_R2_001_BHKWV3CCXY P10859_101_S1_L002_R1_001_BHKWV3CCXY 4T1_S1_L002_R1_001_BHKWV3CCXY P10859_101_S1_L002_R2_001_BHKWV3CCXY 4T1_S1_L002_R2_001_BHKWV3CCXY P10859_102_S2_L003_R1_001_BHKWV3CCXY B16-OVA_S2_L003_R1_001_BHKWV3CCXY P10859_102_S2_L003_R2_001_BHKWV3CCXY B16-OVA_S2_L003_R2_001_BHKWV3CCXY P10859_102_S2_L004_R1_001_BHKWV3CCXY B16-OVA_S2_L004_R1_001_BHKWV3CCXY P10859_102_S2_L004_R2_001_BHKWV3CCXY B16-OVA_S2_L004_R2_001_BHKWV3CCXY
2024-01-31 | E-MTAB-13635 | biostudies-arrayexpress
Project description:Microaaray data for CD44v8-10-positive / CD44v8-10-negative 4T1 cancer cells (mouse breast cancer cells) We used microarrays to detail the global programming of gene expression of 4T1 cells depending on whether CD44v is present or not. 4T1 cells, one of the mouse breast cancer cells, were selected for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain the data about to which extent gene expression profile is different between CD44v-positive and CD44v-negative 4T1 cancer cells.
2012-02-15 | E-GEOD-35803 | biostudies-arrayexpress
Project description:Increasing pre-clinical data suggest that chemotherapy may elicit pro-metastatic responses in breast cancer models. Primary tumours release extracellular vesicles (EVs) that can facilitate the seeding and growth of metastatic cancer cells in distant organs, but the effects of chemotherapy on pro-metastatic EVs are poorly understood. The goal of the project was to analyse the protein content in EVs released by the mouse breast cancer cell line 4T1 after treatment with the chemotherapeutic agent paclitaxel (PTX) or its vehicle control cremophor (CREMO).
2019-01-02 | PXD010362 | Pride
Project description:Glycogene expression changes between different passages in the 4T1 Mouse metastatic breast cancer cell line
| PRJNA137039 | ENA
Project description:In this project, 4T1 parental cells (4T1/WT) were exposed to increasing concentrations of epirubicin (EPB) to establish a novel multi-drug resistant CSC-like breast cancer cell line (4T1/EPB). The ubiquitinated proteins were enriched from 4T1/WT or 4T1/EPB derived cell lysate using a-Al2O3-Vx3 nanoparticles to produce the covalently linked product UPs nanovaccine. Label-free LC-MS/MS mass spectrometry was used to detect the type and amount of enriched proteins of UPs from the 4T1/WT cells and the 4T1/EPB cells.
2021-08-20 | PXD027822 | Pride
Project description:By combining RNAi-mediated knockdown of Id1 and Id3 in an aggressive mouse breast cancer cell line (4T1 cells) with genome-wide expression profiling, we identified several new Id target genes and novel pathways regulated by Id.
2020-10-31 | GSE129790 | GEO
Project description:This study set out to identify TGFb1 transcriptional targets in breast cancer cells. 4T1 breast cancer cells were treated with TGFb1 for 24h and transcripts that were significantly regulated were identified. Wisp1 was identified as one of the genes most highly upregulated by TGFb1. To identify the transcriptional targets of Wisp1, 4T1 cells were then virally transduced to increase Wisp1 expression. The gene expression profiles of Wisp1-overexpressing 4T1 cells were determined and revealed that Wisp1 overexpression does not result in major gene expression changes in 4T1 cells.
2019-07-08 | GSE110912 | GEO