Ontology highlight
ABSTRACT:
PROVIDER: PRJNA380637 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:CRISPR-mediated Isolation of Specific Megabase Segments of Genomic DNA
| PRJNA380625 | ENA
Project description:Our understanding of the functions of DNA elements is limited by the paucity of information about the spectrum of proteins that occupy these genomic regions. Here we describe an approach to identify proteins associated with genomic regions whose chromatin is marked by specific modified histones, which we term chromatin profiling. We used chromatin immunoprecipitation followed by mass spectrometry (ChIP-MS) to identify proteins associated with genomic regions marked by histone H3K27Ac, H3K4me3, H3K79me2 and H3K36me3 in mouse embryonic stem (mES) cells. We identified 385 known and 224 novel candidate proteins associated with these histone-marked genomic segments and confirmed that several of the novel candidates are indeed associated with histone-marked segments of the genome. Future study of the novel candidates, many of which have been implicated in various diseases, should lead to an improved understanding of gene control and its dysregulation in disease. ChIP-seq for nucleosomes with modified histones and DNA-binding proteins in mouse embryonic stem cells, and DNA-binding proteins in Jurkat cells
2015-02-05 | E-GEOD-62380 | biostudies-arrayexpress
Project description:Copy number variant (CNV) analysis was performed on renal cell carcinoma (RCC) specimens (chromophobe, clear cell, oncocytoma, papillary type 1, papillary type 2) using high resolution arrays (1.85 million probes). RCC samples exhibited diverse genomic changes within and across tumor types ranging from 106 CNV segments in a clear cell specimen to 2238 CNV segments in a papillary type 2 specimen. Despite the genomic heterogeneity, distinct CNV segments were common within each of 4 tumor classifications: chromophobe (7 segments), clear cell (3 segments), oncocytoma (9 segments), and papillary type 2 (2 segments). Shared segments ranged from a 6.1 Kb deletion among oncocytomas to a 208.3 Kb deletion common to chromophobes. Among common tumor type-specific variations, chromophobe, clear cell and oncocytomas comprised exclusively non-coding DNA. No CNV regions were common to papillary type 1 specimens although there were 12 amplifications and 12 deletions in 5 of 6 samples. Three microRNAs and 12 mRNA genes had ≥ 98% of their coding region contained within CNV regions including multiple gene families (chromophobe: amylase 1A, 1B, 1C; oncocytoma: general transcription factor 2H2, 2B, 2C, 2D). Gene deletions involved in histone modification and chromatin remodeling affected individual subtypes (clear cell: SFMBT, SETD2; papillary type 2: BAZ1A) as well as the collective RCC group (KDM4C). The genomic amplifications/deletions identified in each renal tumor type represent potential diagnostic and/or prognostic biomarkers.
2012-04-29 | GSE34676 | GEO
Project description:Inserting large DNA payloads (>5 kb) into specific genomic sites of mammalian cells remains challenging. We have merged the strengths of different classes of site-specific recombinases and combine these with CRISPR/Cas9-mediated homologous recombination to develop a strategy for targeted DNA integration of huge constructs (e.g. >170 kb) as well as stringent site-specific replacement of genomic fragments >50 kb in size in human induced pluripotent stem cells. In order to validate the genome integrity of the payloads integrated by STRAIGHT-IN (Serine and Tyrosine Recombinase Assisted Integration of Genes for High-Throughput INvestigation), we performed next generation sequencing (i.e. whole genome and targeted capture sequencing) on the resulting genetically modified cell lines. We have deposited here the raw data.
2022-09-22 | E-MTAB-11971 | biostudies-arrayexpress
Project description:Organisms invest significant effort into maintaining genome stability. However, in diverse groups of eukaryotes, portions or entire chromosomes are lost in early development or during sex determination, a process known as programmed DNA elimination. Little is known about how different segments of the genome are reproducibly retained and discarded during programmed DNA elimination. We tested the hypothesis that selective retention is mediated by regulation of centromere-mediated association of chromosome segments with the mitotic spindle. We report that on the holocentric chromosomes of the nematode Ascaris, the core centromeric histone CENP-A is localized differently in cells undergoing DNA elimination from those undergoing germline mitosis. Prior to DNA elimination, CENP-A is significantly reduced in chromosome regions that will be lost. CENP-A reduction in eliminated genomic regions leads to the absence of kinetochores and microtubule attachment sites necessary for chromosome segregation, and thus the loss of these DNA regions during Ascaris programmed DNA elimination. Our results show that holocentric chromosome organization in Ascaris is regulated and that changes in CENP-A deposition specify which portions of chromosomes will be eliminated during programmed DNA elimination. A total of 62 samples are analyzed. These include: (1). CENP-A ChIP-seq on 12 developmental stages with input and replicates (12 x 2 x 2 samples); (2). CENP-C ChIP-seq on 3 developmental stages with input and replicates (total 8 samples); and (3). Histone marks ChIP-seq with 6 samples
2016-07-15 | E-GEOD-76914 | biostudies-arrayexpress
Project description:Mammalian genomes are organized by multi-layered chromatin folding. How three-dimensional genome organization contributes to cell-type specific transcription remains unclear. We uncover genomic elements termed base-unpairing regions (BURs), distributed genome-wide, as the sole and direct targets of cell-type specific SATB1 protein in vivo. The SATB1 direct-binding profile was generated by analyzing stringently-purified genomic DNA crosslinked to its directly-bound proteins only (ureaChIP-seq). Furthermore, a SATB1-bound BUR interacts extensively and frequently over the entire 5.7 megabase gene-rich region within many regulatory regions, including those near SATB1-dependent Rag1/Rag2 genes. SATB1 depletion leads to major loss of these interactions with greatly reduced Rag1/Rag2 expression. Most BURs reside within lamina associated domains (LADs), among which SATB1 binds to cell-type specific groups of BURs. Genome organization mediated by CTCF and SATB1 are distinct as these proteins do not co-bind chromatin in vivo and their direct binding sites are mutually exclusive genome-wide. These results revealed a previously undetected chromatin organization mediated by SATB1 direct binding to selected BURs genome-wide and suggest that chromatin interactions from some of these BURs provide a regulatory network underlying cell-type specific gene expression.
2021-12-28 | GSE191146 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Synthetic DNA-binding proteins have found broad application in gene therapies and as tools for interrogating biology. Engineered proteins based on the CRISPR/Cas9 and TALE systems have been used to alter genomic DNA sequences, control transcription of endogenous genes, and modify epigenetic states. Although the activity of these proteins at their intended genomic target sites have been assessed, the genome-wide effects of their action have not been extensively characterized. Additionally, the role of chromatin structure in determining the binding of CRISPR/Cas9 and TALE proteins to their target sites and the regulation of nearby genes is poorly understood. Characterization of the activity these proteins using modern high-throughput genomic methods would provide valuable insight into the specificity and off-target effects of CRISPR- and TALE-based genome engineering tools. We have analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators targeted to the promoters of two different endogenous human genes in HEK293T cells using a variety of high-throughput DNA sequencing methods. In particular, we assayed the DNA-binding specificity of these proteins and their effects on the epigenome. DNA-binding specificity was evaluated by ChIP-seq and RNA-seq was used to measure the specificity of these activators in perturbing the transcriptome. Additionally, DNase-seq was used to identify the chromatin state at target sites of the synthetic transcriptional activators and the genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these genome engineering technologies are highly specific in both binding to their promoter target sites and inducing expression of downstream genes when multiple activators bind to a single promoter. Moreover, we show that these synthetic activators are able to induce the expression of silent genes in heterochromatic regions of the genome by opening regions of closed chromatin and decreasing DNA methylation. Interestingly, the transcriptional activation domain was not necessary for DNA-binding or chromatin remodeling in these regions, but was critical to inducing gene expression. This study shows that these CRISPR- and TALE-based transcriptional activators are exceptionally specific. Although we detected limited binding of off-target sites in the genome and changes to genome structure, these off-target event did not lead to any detectable changes in gene regulation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. HEK293T cells were transfected in triplicate with plasmids expressing synthetic transcription factors. The synthetic TFs were either (a) dCas9-VP64 fusion protein and a targeting guide RNA (gRNA), or (b) a TALE-VP64 fusion protein engineered to bind to a specific target site in the genome. As a control, cells were transfected with plasmids expressing GFP. After transfection, ChIP-seq was used to identify both on-target and off-target binding sites for the synthetic TFs.
2015-04-24 | E-GEOD-57085 | biostudies-arrayexpress
Project description:Our understanding of the functions of DNA elements is limited by the paucity of information about the spectrum of proteins that occupy these genomic regions. Here we describe an approach to identify proteins associated with genomic regions whose chromatin is marked by specific modified histones, which we term chromatin profiling. We used chromatin immunoprecipitation followed by mass spectrometry (ChIP-MS) to identify proteins associated with genomic regions marked by histone H3K27Ac, H3K4me3, H3K79me2 and H3K36me3 in mouse embryonic stem (mES) cells. We identified 385 known and 224 novel candidate proteins associated with these histone-marked genomic segments and confirmed that several of the novel candidates are indeed associated with histone-marked segments of the genome. Future study of the novel candidates, many of which have been implicated in various diseases, should lead to an improved understanding of gene control and its dysregulation in disease.
2015-02-05 | GSE62380 | GEO
Project description:Polycomb-repressive complex 1 (PRC1) has a constraining influence on 3D genome organization, mediating localized and chromosome-wide clustering of target loci. Polycomb-bound regions form transcriptionally repressive chromatin domains independent of topologically associating domains (TADs). Several subunits of PRC1 have the capacity to form biomolecular condensates through liquid-liquid phase separation (LLPS) in vitro and when tagged and over-expressed in cells. Here, we use 1,6 hexandiol (1,6-HD), which disrupts liquid-like condensates, to examine the role of endogenous PRC1 biomolecular condensates on local and chromosome-wide clustering of PRC1-bound loci. Using imaging and chromatin immunoprecipitation combined with deep sequencing (ChIP-seq) analyses, we show that PRC1-mediated localized chromatin compaction and clustering of targeted genomic loci at megabase and tens of megabase scales can be reversibly disrupted by the addition and subsequent removal of 1,6-HD to mouse embryonic stem cells (mESCs). Decompaction and dispersal of polycomb domains and clusters cannot be solely attributable to the reduction of PRC1 binding following 1,6-HD treatment as the addition of 2,5-HD has similar effects despite this alcohol not perturbing PRC1-mediated clustering, at least at the sub-megabase and megabase scales. These results suggest that weak, hydrophobic interactions between PRC1 molecules characteristic of liquid condensates do have a role in polycomb-mediated genome organization.
2023-02-13 | GSE224930 | GEO