Ontology highlight
ABSTRACT:
PROVIDER: PRJNA483000 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The targeting range of CRISPR-Cas9 base editors (BEs) is limited by their G/C-rich PAM sequences. To overcome this limitation, we developed a CRISPR/Cpf1-based BE by fusing the rat cytosine deaminase APOBEC1 to a catalytically inactive version of Lachnospiraceae bacterium Cpf1. The base editor recognizes a T-rich PAM sequence and converts C to T in human cells with low levels of indels, non-C-to-T substitutions and off-target editing.
2018-03-18 | GSE110136 | GEO
Project description:C-to-T base editing mediated by CRISPR/Cas9 base editors (BEs) needs a G/C-rich PAM and the editing fidelity is compromised by unwanted indels and non-C-to-T substitutions. We developed CRISPR/Cpf1-based BEs to recognize a T-rich PAM and induce efficient C-to-T editing with few indels and/or non-C-to-T substitutions. The requirement of editing fidelity in therapeutic-related trials necessitates the development of CRISPR/Cpf1-based BEs, which also facilitates base editing in A/T-rich regions.
2018-10-16 | GSE105002 | GEO
Project description:We report the PAMs of phylogenetically-diverse Cas12a nucleases using a cell-free TXTL-based PAM screen. By adding a 5N randomized PAM library and Cas12a-gRNA in vitro, recognized PAM sequences were cleaved, while non-recognized PAMs remained. By amplifying the non-cleaved DNA, we used next-generation sequencing to analyze the depletion of functional PAMs of these Cas12a nucleases.
2020-03-02 | GSE130377 | GEO
Project description:The type V-I CRISPR-Cas system is becoming increasingly attractive for its potential utility in gene editing. However, natural nucleases often exhibit low efficiency, limiting their application. Here, we utilized structure-guided rational design and combinatorial protein engineering to optimize an uncharacterized Cas12i nuclease, Cas12i3. Accordingly, we developed Cas-SF01, a Cas12i3 variant that exhibits significantly improved gene-editing activity in mammalian cells and plants. Cas-SF01 displays comparable or superior editing performance compared to SpCas9 or recently engineered Cas12 nucleases. Further analysis of PAM recognition showed that Cas-SF01 has an expanded PAM range and effectively recognizes NTTN and noncanonical NATN and TTVN PAMs. Additionally, we identified an amino acid substitution, D876R, that markedly reduced the off-target effect while maintaining high on-target activity, leading to the development of Cas-SF01HiFi (high-fidelity Cas-SF01). Finally, we demonstrated that Cas-SF01 has robust gene-editing activity in both the monocot plant rice and dicot plant pepper. Our results suggest that Cas-SF01 can serve as a robust gene-editing platform with high efficiency and specificity for future genome editing applications across different organisms.
2023-11-05 | GSE236755 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Randomized PAM depletion of phylogenetically-diverse Cas12a nucleases
| PRJNA539942 | ENA