IDLV capture for gRNA off-target analysis
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA552824 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Vector capturing was used for experimental identification of potential off-target sites of 2 gRNA targeting alpha globin genes
2020-05-26 | GSE133861 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:RNASeq of Arg2 gRNA or scrambled gRNA CRISPR'd Tregs
| PRJNA588065 | ENA
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:RNA-Seq after Cas9-gRNA transfection with different length gRNAs we performed PolyA Selection and RNA-Seq on cells transfected with dCas9-VPR and a gRNA of each length (20nt, 16nt, or 14nt) targeting ACTC1, MIAT, or HBG1/2
2015-07-15 | E-GEOD-70694 | biostudies-arrayexpress
Project description:Transcriptional profiling of zebrafish embryos comparing wild type untreated embryos with embryos injected with morpholino of zf-grna. This assay is used for the determination of expression profiling at 22 hpf under GRN-A deficiency. Two-condition experiment: wild type vs. MO-grnA treated cells. 3 biological replicates: each group contains 200 embryos.
2013-03-28 | E-GEOD-28318 | biostudies-arrayexpress
Project description:Igk locus capture-based target enrichment sequencing
| PRJNA574914 | ENA
Project description:Our data demonstrate the suitability of target capture technology for purifying very low quantities of Leptospira DNA from biological samples where the human genome is in vast excess. This enables deep sequencing of partial Leptospira genomes directly from clinical samples using next generation technologies and genotyping.
2022-05-23 | E-MTAB-11667 | biostudies-arrayexpress
Project description:The combination of single-cell RNA sequencing with CRISPR inhibition/activation provides a high-throughput approach to simultaneously study the effects of hundreds if not thousands of gene perturbations in a single experiment. One recent development in CRISPR-based single-cell techniques introduces a feature barcoding technology which allows for the simultaneous capture of mRNA and gRNA from the same cell. This is achieved by introducing a capture sequence, whose complement can be incorporated into each gRNA, and which can be used to amplify these features prior to sequencing. However, with the technology in its infancy, there is little information available on how such experimental parameters can be optimised. To overcome this, we varied the capture sequence, capture sequence position and gRNA backbone to identify an optimal gRNA scaffold for CRISPR-activation gene perturbation studies. We provide a report on our screening approach along with our observations and recommendations for future use.
2021-01-08 | GSE164393 | GEO
Project description:Transcriptional profiling of zebrafish embryo comparing wild type untreated embryos with embryos injected with morpholino of zf-grna. This assay is used for determination of expression profiling of trunk muscle at 16, 24, 48, 72 hpf under GRN-A deficiency. Two-condition experiment, wild type vs. MO-grnA treated cells. Biological replicates: each group contains 200 embryos.
2013-06-01 | E-GEOD-38441 | biostudies-arrayexpress