Gordonibacter pamelaeae strain:3C
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA557714 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Scytalidium sp. 3C strain:3C Genome sequencing and assembly
| PRJNA243259 | ENA
Project description:Verrucomicrobium sp. 3C strain:3C Genome sequencing and assembly
| PRJNA165235 | ENA
Project description:Starkeya sp. 3C strain:3C Genome sequencing and assembly
| PRJNA555575 | ENA
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:Setup Pacbio sequencing in combination with 3C
2020-09-12 | GSE146945 | GEO
Project description:Gordonibacter pamelaeae 7-10-1-b genome sequencing project
| PRJNA39175 | ENA
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells.
2014-02-22 | GSE55261 | GEO
Project description:RNA timecourse data for Streptomyces fradiae wildtype (ATCC19609) and overproducing strain KOS155-3C(RUS). Strains were grown at 30 C in shake flask cultures in R5 medium with no glucose. RNA samples were harvested over 5 days as tylosin was produced. 12 h RNA samples of each strain were used as the reference sample(green) within their respective timecourses. The WT gDNA vs. 12 h RNA control displays relative gene expression at the beginning of the timecourse. The 12 h RNA control compares initial RNA levels between the WT and overproducer.
2005-07-21 | E-SMDB-2231 | biostudies-arrayexpress