Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18~20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.
Project description:A three-stage continuous fermentative system was developed to simulate and control physicochemical factors of the gut biology. Inoculation was of each reactor was performed from a human fecal sample which was initially amplified with a batch procedure. Samples from the initial feces, the batch and from the bioreactors media were collected to extract bacterial DNA. 16S PCR amplification was performed to assess the microbial diversity at the family level using the HuGChip. Amplified DNA was purified and labelled with either Cy3 or Cy5 dye and hybridized on the microarray. A 5 chip study was realized, each corresponding to hybridization with 250ng of labelled 16S rRNA gene amplicons from either the initial stool, the batch inoculum or fermentative medium different compartments of the simulated colon (Proximal, Transversal and Distal). Each probe (4441) was synthetized in three replicates.
Project description:To investigate the TVA diet's effect on mouse gut microbiome, we fed C57/BL6 mice with TVA diet or CON diet for 18 days We then collected feces of the mice and performed 16S ribosomal RNA (rRNA) sequencing.
Project description:To address the role of gut microbiota in the development of paclitaxel-induced peripheral neuropathy (PIPN), we performed 16S rRNA sequencing analysis of feces samples at 14 days and 28 days after the initiation of paclitaxel or vehicle injections.
Project description:To compare the similarities and differences in species diversity of the gut microbiota between the patients with melasma and healthy subjects. The feces were collected for 16S rRNA sequencing analysis of the gut microbiota.
Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.