Soil samples
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA588632 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Illumina MiSeq high-throughput sequencing for six opencast coal mine sites Raw sequence reads
| PRJNA533184 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:In this project, in vitro selection was carried out to generate DNAzymes for Eosinophil peroxidase using a synthetic DNA library. Total 15 rounds of selections were carried out. The DNA molecules obtain in round 15, was applied in Illumina MiSeq deep sequencing which provided fastq files. Sequencing samples were prepared from each parallel SELEX experiment by PCR tagging with Illumina sequencing primers. Samples were size purified by agarose gel electrophoresis prior to being quantified by measuring absorbance at 260 nm. Tagged samples were pooled and paired-end sequenced on an Illumina MiSeq high-throughput DNA sequencer. Sequence data processing was performed on a Windows 10 computer running Ubuntu 20.04 under WSL2. Raw paired-end reads were trimmed of sequencing and library primers using cutadapt 3.4. Trimmed paired-end reads were then: 1) merged into a consensus sense read; 2) dereplicated; and, 3) clustered at 90% identity using USEARCH v11.0.667_i86linux32. Sequence frequencies and ranking lists were generated using custom Python scripts. Multiple sequence alignments were performed using MUSCLE v3.8.1551 and converted to sequence logos using WebLogo 3.7.8. Processed sequencing data and cluster linkage data were stored on a MySQL 8.0.22 database. Analysis of sequence copy number, frequency, cluster linkage and data plots were performed using the database and Microsoft Excel Top 20 sequences were tested for cleavage performance. The most active DNAzyme was characterized and optimized. At the end, fluorescence and lateral flow assays were developed and evaluated in real patients' sputums.
2023-11-15 | GSE217946 | GEO
Project description:Methods: The cDNA libraries from 3 pooled samples of cultured cells for each group were sequenced to generate RNA profiles using Illumina Miseq platform Results: The sequencing runs yielded a total of 95.01 M reads with an average length of 73-74 bp. The high-throughput sequencing performed for liver samples with different treatments showed similar numbers of yielded reads ranged from 5.57 to 5.74 M and the same average length. The Strand NGS software (version 2.1) was used using default parameters for pre-alignment and post-alignment quality control analysis and 100% of the raw reads remained in the dataset. Of these, 19.02 M reads (84%) were mapped into contigs of the rat genome (rn5) and identified 31457 transcripts in liver samples.
2017-01-31 | GSE86344 | GEO
Project description:Methods: The cDNA libraries from 3 pooled samples of liver tissues for each group were sequenced to generate RNA profiles using Illumina Miseq platform Results: The sequencing runs yielded a total of 22.67 M reads with an average length of 100 bp. The high-throughput sequencing performed for liver samples with different treatments showed similar numbers of yielded reads ranged from 5.57 to 5.74 M and the same average length. The Strand NGS software (version 2.1) was used using default parameters for pre-alignment and post-alignment quality control analysis and 100% of the raw reads remained in the dataset. Of these, 19.02 M reads (84%) were mapped into contigs of the rat genome (rn5) and identified 31457 transcripts in liver samples.
2015-10-01 | GSE69783 | GEO
Project description:Study of the mechanisms of RecB mutant terminus DNA loss in Escherichia coli. FX158: WT MG1655 FX35: recB- FX37: ruvAB- FX51: matP- MIC18: recB- sbcD- sbcC- MIC20: recB- ruvAB- MIC24: matP- recB- MIC25: recA- recB- MIC31: sbcB- sbcD- MIC34: recA- recD- MIC40: linear chromosome MIC41: linear chromosome recB- MIC42: matP- ftsKC- MIC43: matP- ftsKC- recB- MIC48: recA- Cells were grown in M9 minimal medium supplemented with 0.4 % glucose to exponential phase (0.2 OD 650 nm). Chromosomal DNA was extracted using the Sigma GenElute bacterial genomic DNA kit. 5 μg of DNA were used to generate a genomic library according to Illumina's protocol. The libraries and the sequencing were performed by the High-throughput Sequencing facility of the I2BC (http://www.i2bc.paris-saclay.fr/spip.php?article399&lang=en, CNRS, Gif-sur-Yvette, France). Genomic DNA libraries were made with the ‘Nextera DNA library preparation kit’ (Illumina) following the manufacturer’s recommendations. Library quality was assessed on an Agilent Bioanalyzer 2100, using an Agilent High Sensitivity DNA Kit (Agilent technologies). Libraries were pooled in equimolar proportions. 75 bp single reads were generated on an Illumina MiSeq instrument, using a MiSeq Reagent kit V2 (500 cycles) (Illumina), with an expected depth of 217X. An in-lab written MATLAB-based script was used to perform marker frequency analysis. Reads were aligned on the Escherichia coli K12 MG1655 genome using BWA software. Data were normalized by dividing uniquely mapping sequence reads by the total number of reads. Enrichment of uniquely mapping sequence reads in 1 kb non-overlapping windows were calculated and plotted against the chromosomal coordinates.
2017-11-10 | E-MTAB-6122 | biostudies-arrayexpress
Project description:Amplicon-based targeted re-sequencing analysis was performed in the patient-derived gliobastoma cell culture samples. For this purpose, genomic DNA (gDNA) was isolated and DNA libraries were prepared using the TruSeq Custom Amplicon Low Input (Illumina, Inc.) technology. By this, a pool of 375 amplicons was generated for each single sample in order to enrich for the target genes ATRX1, EGFR, IDH1, NF1, PDGFRA, PIK3CG, PIK3R1, PTEN, RB1 and TP53. Sequencing was performed on the Illumina MiSeq® next generation sequencing system (Illumina Inc.) and its 2 x 250 bp paired-end v2 read chemistry. The resulting reads were quality controlled and mapped against the human reference genome (hg19). For all samples, sequence variations of the amplified regions of interest in comparison to the human reference sequence were identified and filtered based on reliability.
2021-07-07 | E-MTAB-9343 | biostudies-arrayexpress
Project description:Genotyping of RpoD mutants via amplicon sequencing from the following manuscript: \\"Systematic dissection of σ70 sequence diversity and function in bacteria\\" by Park and Wang (2020). Includes raw sequencing reads from samples from MAGE-seq single codon saturation mutagenesis and high-throughput fitness competition experiment as well as the RpoD ortholog mutants generated through recombineering and CRISPR selection.
2022-06-06 | E-MTAB-9103 | biostudies-arrayexpress
Project description:Nitrate-reducing iron(II)-oxidizing bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture KS. Raw sequencing data of 16S rRNA amplicon sequencing, shotgun metagenomics (short reads: Illumina; long reads: Oxford Nanopore Technologies), metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA682552. This dataset contains proteomics data for 2 conditions (heterotrophic and autotrophic growth conditions) in triplicates.
2021-05-17 | PXD023186 | Pride