Faecal fermentation samples
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA650589 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Objective: To study the effect of astragalus polysaccharide combined with metformin on mRNA expression profile of type 2 diabetic mice, and to explore the molecular mechanism of astragalus polysaccharide combined with metformin in the treatment of type 2 aging diabetes. Methods: Natural aging mice were induced by high-sugar and high-fat diet combined with streptozotocin to prepare aging diabetes model. The experimental mice were divided into aging control group, aging diabetes model group, metformin treatment group, astragalus polysaccharide and metformin. The treatment group was treated with gavage for 60 consecutive days. Immunohistochemical detection of insulin levels in pancreatic tissue of each group of mice, serum insulin levels were measured by mouse insulin kit to observe the treatment of aging diabetes and astragalus polysaccharide combined with metformin; using Agilent mouse whole gene expression profile chip The mRNA expression changes of liver tissues in each group were analyzed, and the differential genes were screened by bioinformatics tools and the differential genes and signal pathways were enriched and analyzed. Results: Compared with the aging group, the insulin and insulin antibody levels in the model group were significantly decreased (P<0.05). Compared with the model group, the insulin and insulin antibody levels in the two treatment groups increased (P<0.05), and jaundice The level of polysaccharide in combination with metformin was significantly higher than that in metformin group (P<0.05). The differential gene analysis of the chip showed that there were 5617 differential genes in the aging diabetes model group, 3131 were up-regulated, and 2486 were down-regulated; the Astragalus polysaccharide combined with metformin treatment group had 4767 differential genes, compared with the aging diabetes model group. 2143 up-regulated, 2624 down-regulated, genes with significant differences were mainly involved in protease activity and drug metabolism, and significantly enriched into 33 signaling pathways (P<0.01). Conclusion: The gene regulatory network plays an important role in the intervention of Astragalus polysaccharides and metformin in the treatment of aging type 2 diabetes.
2022-06-12 | GSE132599 | GEO
Project description:Objective: To study the effect of astragalus polysaccharide combined with metformin on mRNA expression profile of type 2 diabetic mice, and to explore the molecular mechanism of astragalus polysaccharide combined with metformin in the treatment of type 2 aging diabetes. Methods: Natural aging mice were induced by high-sugar and high-fat diet combined with streptozotocin to prepare aging diabetes model. The experimental mice were divided into aging control group, aging diabetes model group, metformin treatment group, astragalus polysaccharide and metformin. The treatment group was treated with gavage for 60 consecutive days. Immunohistochemical detection of insulin levels in pancreatic tissue of each group of mice, serum insulin levels were measured by mouse insulin kit to observe the treatment of aging diabetes and astragalus polysaccharide combined with metformin; using Agilent mouse whole gene expression profile chip The mRNA expression changes of liver tissues in each group were analyzed, and the differential genes were screened by bioinformatics tools and the differential genes and signal pathways were enriched and analyzed. Results: Compared with the aging group, the insulin and insulin antibody levels in the model group were significantly decreased (P<0.05). Compared with the model group, the insulin and insulin antibody levels in the two treatment groups increased (P<0.05), and jaundice The level of polysaccharide in combination with metformin was significantly higher than that in metformin group (P<0.05). The differential gene analysis of the chip showed that there were 5617 differential genes in the aging diabetes model group, 3131 were up-regulated, and 2486 were down-regulated; the Astragalus polysaccharide combined with metformin treatment group had 4767 differential genes, compared with the aging diabetes model group. 2143 up-regulated, 2624 down-regulated, genes with significant differences were mainly involved in protease activity and drug metabolism, and significantly enriched into 33 signaling pathways (P<0.01). Conclusion: The gene regulatory network plays an important role in the intervention of Astragalus polysaccharides and metformin in the treatment of aging type 2 diabetes.
2019-12-06 | GSE124813 | GEO
Project description:In vitro fermentation using infant faecal microbiota isolate:In vitro fermentation using infant faecal microbiota | cultivar:Infant Metagenome
| PRJNA312439 | ENA
Project description:In vitro fermentation using elderly faecal microbiota isolate:In vitro fermentation using elderly faecal microbiota | cultivar:Elderly women Metagenome
| PRJNA312440 | ENA
Project description:High-throughput sequencing of in vitro fecal fermentation samples
| PRJNA821446 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Methanogen diversity in the rumen in vitro fermentation culture
| PRJNA379053 | ENA