Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

High-throughput sequencing of in vitro fecal fermentation samples

ABSTRACT: High-throughput sequencing of in vitro fecal fermentation samples

PROVIDER: PRJNA821446 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Similar Datasets

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Faecal fermentation samples

Project description:In vitro fermentation of Astragalus polysaccharide

| PRJNA650589 | ENA

In vitro rumen fermentation

Project description:In vitro rumen fermentation Raw sequence reads

| PRJNA560091 | ENA

Role of folic acid in regulating intestinal flora and short-chain fatty acids based on in vitro fermentation model

Project description:Folic acid deficiency is common worldwide and is linked to intestinal flora imbalance. The intestinal microbial utilization of folic acid based on model animals faces the challenges of repeatability and individual variability. In this study, we built an in vitro fecal slurry culture model deficient in folic acid. We examined the effects of supplementation with different forms of folic acid (5-methyltetrahydrofolate and non-reduced folic acid) on the modulation of intestinal flora. 16S rDNA gene sequencing showed alpha diversity increased after folic acid supplementation compared to fermentation samples with folic acid deficiency. In the non-reduced folic acid (FA) group, the relative abundance of the Firmicutes phylum dropped to 56.7%, whereas in the 5-methyltetrahydrofolate (MTHF) supplementation group, it grew to 64.9%. Lactobacillus genera became more prevalent, reaching 22.8% and 30.8%, respectively. Additionally, Bifidobacterium and Pedioccus, two common probiotic bacteria, were in higher abundance. Short-chain fatty acids (SCFAs) analysis showed that supplementation with folic acid (non-reduced folic acid, 5-methyltetrahydrofolate) decreased acetic acid and increased the fermentation yield of isobutyric acid. The in vitro fecal slurry culture model developed in this study can be utilized as a human folic acid deficiency model for studying intestinal microbiota and demonstrated that both 5-methyltetrahydrofolate and non-reduced folic acid have effects on the regulation of intestinal microecology.

2024-03-01 | GSE227224 | GEO

In vitro batch fermentation by-products

Project description:In vitro batch fermentation by-products

| PRJEB38263 | ENA

High-throughput in vitro DROSHA processing on artificial variants

Project description:High-throughput in vitro DROSHA processing on artificial variants

| PRJNA544246 | ENA

Fermentation samples

Project description:Fermentation samples Metagenome

| PRJNA801694 | ENA

In vitro polyphenol fermentation.

Project description:In vitro fermentation of gut bacteria with polyphenols adsorbed to apple cell walls.