Desulfonema ishimotonii
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA657647 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The TDP-43 proteinopathies, which include amyotrophic lateral sclerosis and frontotemporal dementia, are a devastating group of neurodegenerative disorders that are characterized by the mislocalization and aggregation of TDP-43. Here we demonstrate that RNA-targeting CRISPR effector proteins, a programmable class of gene silencing agents that includes the Cas13 family of enzymes and Cas7-11, can be used to mitigate TDP-43 pathology when programmed to target ataxin-2, a modifier of TDP-43-associated toxicity. In addition to inhibiting the aggregation and transit of TDP-43 to stress granules, we find that the in vivo delivery of an ataxin-2-targeting Cas13 system to a mouse model of TDP-43 proteinopathy improved functional deficits, extended survival, and reduced the severity of neuropathological hallmarks. Further, we benchmark RNA-targeting CRISPR platforms against ataxin-2 and find that high-fidelity forms of Cas13 possess improved transcriptome-wide specificity compared to Cas7-11 and a first-generation effector. Our results demonstrate the potential of CRISPR technology for TDP-43 proteinopathies.
2023-09-28 | GSE244306 | GEO
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114858 | GEO
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114857 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:CRISPR technologies have begun to revolutionize T cell therapies; however, conventional CRISPR/Cas9 genome-editing tools are limited in their safety, efficacy, and scope. To address these challenges, we developed MEGA (Multiplexed Effector Guide Arrays), a platform for programmable and scalable regulation of the T cell transcriptome using the RNA-guided, RNA-targeting activity of CRISPR/Cas13d. MEGA enables quantitative, reversible, and massively-multiplexed gene knockdown in primary human T cells without targeting or cutting genomic DNA. Applying MEGA to a model of CAR T cell exhaustion, we robustly suppressed inhibitory receptor upregulation and uncovered paired regulators of T cell function through combinatorial CRISPR screening. We additionally implemented druggable regulation of MEGA to control CAR activation in a receptor-independent manner. Lastly, MEGA enabled multiplexed disruption of immunoregulatory metabolic pathways to enhance CAR T cell fitness and anti-tumor activity in vitro and in vivo. MEGA offers a versatile synthetic toolkit for applications in cancer immunotherapy and beyond.
2023-11-06 | GSE246823 | GEO
Project description:CRISPR-Cas immune systems function to defend prokaryotes against potentially harmful mobile genetic elements including viruses and plasmids. The multiple CRISPR-Cas systems (Types I, II, III) each recognize and target destruction of foreign invader nucleic acids via structurally and functionally diverse effector complexes (crRNPs). CRISPR-Cas effector complexes are comprised of CRISPR RNAs (crRNAs) that contain sequences homologous to the invading nucleic acids and Cas proteins specific to each immune system type. We have previously characterized a crRNP in Pyrococcus furiosus (Pfu) that contains Cmr proteins (Type III-B) associated with one of two primary size forms of crRNAs and functions through homology-dependent cleavage of target RNAs. In the current study, we have isolated and characterized two additional native Pfu CRISPR-Cas complexes containing either Csa (Type I-A) or Cst (Type I-G) proteins and distinct profiles of associated crRNAs. For each complex, the Cas proteins were identified by tandem mass spectrometry and immunoblotting and the crRNAs by RNA deep sequencing and Northern blot analysis. The crRNAs associated with both the Csa and Cst complexes originate from each of seven total CRISPR loci and contain identical 5’ ends (8-nt CRISPR RNA repeat-derived 5’ tag sequences) but heterogeneous 3’ ends (containing variable amounts of downstream repeat sequences). These crRNA forms are distinct from Cmr-associated crRNAs, indicating different 3’ end processing pathways following primary cleavage of common pre-crRNAs. We predict that the newly identified Pfu Type I-A (Csa) and Type I-G (Cst)-containing crRNPs, like other previously characterized Type I CRISPR-Cas effector complexes, each function by carrying out crRNA-guided DNA targeting of invading mobile genetic elements. Taken together, our in-depth characterization of the three isolated native complexes provides clear evidence for three compositionally distinct crRNPs containing either Cmr, Csa, or Cst Cas proteins that together make up an impressive arsenal of CRISPR-Cas defense for a single organism. 4 Samples: Protein-associated small RNAs
2015-07-10 | E-GEOD-65781 | biostudies-arrayexpress
Project description:Programmable RNA base editing with a single engineered protein
| PRJNA644735 | ENA
Project description:Programmable RNA-targeting tools provide the unique opportunity to study RNA regulation and control gene expression in an endogenous environment. However, the temporal control over these systems is lacking, rendering studies on the temporal control of regulation challenging. Here, we report the development of a small molecule-controllable RNA effector system to overcome this challenge.
2021-05-02 | GSE149555 | GEO
Project description:CRISPR-SKIP: Programmable Gene Splicing with Single Base Editors [RNA-seq]
| PRJNA437656 | ENA
Project description:We develop a CRISPR-Assisted RNA-Protein Interaction Detection method (CARPID), which leverages CRISPR/CasRx-based RNA targeting and proximity labeling to identify binding proteins of specific lncRNA in the native cellular context.
2020-05-20 | PXD015702 | iProX