Ontology highlight
ABSTRACT:
PROVIDER: PRJNA694226 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Fat body is an important tissue in the context of vitellogenesis, vector immunity, vector physiology and vector-parasite interaction. However, the proteome of this vital organ has not been investigated in any Anopheline species so far. In this study, we employed multiple fractionation method followed by high resolution mass spectrometry to characterize fat body proteome of female mosquitoes An. stephensi Indian strain. In all, we identified 4, 535 proteins in the fat body and a subset of these proteins were found to be restricted to fat body. Gene ontology analysis of these proteins suggested their role in metabolism, lipid transport, vitellogenesis, mosquito immunity and oxidation-reduction processes. By far, this is the largest proteomic resource of fat body in any mosquito species.
2019-01-07 | PXD006677 | Pride
Project description:In this work, we aimed to explore miRNA expression and potential targets in the female fat body of the Ae. aegypti mosquito, as well as their changes as a result of blood meal. The fat body is the metabolic center of the insect organism, playing a key role in reproduction. Therefore, understanding of regulatory networks controlling its functions is critical, and the role of miRNAs in the process is largely unknown. Small RNA library analyses revealed four unique miRNA clusters sequentially expressed during the post blood meal (PBM) phase, drawing connections to waves of upstream hormonal signals and gene expression in the same period. To link the miRNA identities with specific downstream targets, transcriptome-wide mRNA 3' UTR interaction sites were experimentally determined at 72 h post eclosion (PE) and 24 h PBM by means of AGO1 CLIP-seq. Hence, the presented manuscript comprehensively elucidated miRNA expression and target dynamics in female mosquito fat body, providing a solid foundation for future functional studies of miRNA regulation during the gonadotrophic cycle.
2017-03-06 | GSE93345 | GEO
Project description:In honey bees, Vitellogenin (Vg) is hypothesized to be a major factor affecting hormone signaling, food-related behavior, immunity, stress resistance and lifespan. Likewise microRNAs play important roles in posttranscriptional gene regulation and affect many biological processes thereby showing many parallels to Vg functions. The molecular basis of Vg and microRNA interactions is largely unknown. Here, we exploited the well-established RNA interference (RNAi) protocol for Vg knockdown to investigate its effects on microRNA population in honey bee foragerM-bM-^@M-^Ys brain and fat body tissue. To identify microRNAs that are differentially expressed between tissues in control and knockdown foragers, we used M-BM-5ParafloM-BM-. microfluidic oligonucleotide microRNA microarrays. Our results show 76 and 74 miRNAs were expressed in the brain of control and knockdown foragers whereas 66 and 69 miRNAs were expressed in the fat body of control and knockdown foragers respectively. Target prediction identified potential seed matches for differentially expressed subset of microRNAs affected by Vg knockdown. These candidate genes are involved in a broad range of biological processes including insulin signaling, juvenile hormone (JH) and ecdysteroid signaling previously shown to affect foraging behavior. Thus, here we demonstrate a causal link between Vg expression-variation and variation in the abundance of microRNAs in different tissues with possible consequences for regulation of foraging behavior. We knocked down Vitellogenin (Vg) gene expression (using RNAi) in adult workers to identify potential downstream consequences on the expression of microRNA population in the fat body compared to control group (dsRNA-GFP injected bees). Six biological samples of fat body-derived small RNA fraction were prepared for each treatment group (dsRNA-Vg and dsRNA-GFP). Each biological sample contained pooled RNA from 5 unique individuals. Each fat body pool contained a total of 2 M-BM-5g of small RNA fraction, to which each of the 5 individuals contributed equally (400 ng). Pools were named as M-bM-^@M-^\control forager fat bodyM-bM-^@M-^] (GFFb) and M-bM-^@M-^\knockdown forager fat bodyM-bM-^@M-^] (VFFb), followed by a number from 1 to 6.
2013-03-07 | E-GEOD-44916 | biostudies-arrayexpress
Project description:Fat body is an important tissue in the context of vitellogenesis, vector immunity, vector physiology and vector-parasite interaction. However, the proteome of fatbody and impact of blood meal on the gene expression of this vital organ has not been investigated so far. Therefore, in this study, we made an attempt to identify proteins expressed in fatbody of An. stephensi and their altered expression in response to blood meal. In all, we identified 4,504 proteins in the fatbody using multiple fractionation strategies, which is by far the largest resource of fatbody proteome in any mosquito species. Further, comparative proteomic analysis of fatbody 24 and 48 hours post blood meal led to identification of over 300 differentially expressed proteins. Bioinformatics analysis of these proteins suggested their role in vitellogenesis, lipid transport, mosquito immunity and oxidation-reduction processes. Interestingly, we identified four novel genes,which were found to be differentially expressed upon blood meal. These proteins are potential target for vector control strategies and development of transmission blocking vaccines.
2018-01-03 | PXD006462 | Pride
Project description:We characterized insulin receptor (InR)-dependent gene expression in the Drosophila fat body using transgenic RNAi. Chronic knockdown of InR in the fat body was elicited via (r4-GAL4, UAS-InRi) and RNA-seq was used to identify potential target genes.
2017-10-24 | GSE97447 | GEO
Project description:Differentially expressed genes at molting and metamorphosis stages in Bombyx fat body
| PRJNA131043 | ENA
Project description:We compared ecdysone receptor (EcR)-dependent gene expression in the Drosophila fat body on 0.15 M sucrose and 0.5 M sucrose high-sugar diets in order to gain insight into the role of this gene during caloric overload. Phenotypic analyses showed an increased severity of EcR RNAi phenotypes with increasing dietary sugar concentration. Because EcR is a transcription factor, we performed RNA-seq studies to identify transcriptional targets that might underlie insulin resistance downstream of EcR RNAi.
2018-02-10 | GSE110432 | GEO
Project description:We report the transcriptome profile of one sequenced sample of mRNA isolated from pooled (20 from each genotype) abdomen fly extracts enriched in fat body content of fat body-specific Sdc RNAi knockdown and control flies Abdominal fat body mRNA profiles of 4-6-day old control and fat body-specific Sdc RNAi knockdown were generated by deep sequencing using Illumina HiSeq 2500
2016-06-30 | E-GEOD-67001 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:In honey bees, Vitellogenin (Vg) is hypothesized to be a major factor affecting hormone signaling, food-related behavior, immunity, stress resistance and lifespan. Likewise microRNAs play important roles in posttranscriptional gene regulation and affect many biological processes thereby showing many parallels to Vg functions. The molecular basis of Vg and microRNA interactions is largely unknown. Here, we exploited the well-established RNA interference (RNAi) protocol for Vg knockdown to investigate its effects on microRNA population in honey bee forager’s brain and fat body tissue. To identify microRNAs that are differentially expressed between tissues in control and knockdown foragers, we used µParaflo® microfluidic oligonucleotide microRNA microarrays. Our results show 76 and 74 miRNAs were expressed in the brain of control and knockdown foragers whereas 66 and 69 miRNAs were expressed in the fat body of control and knockdown foragers respectively. Target prediction identified potential seed matches for differentially expressed subset of microRNAs affected by Vg knockdown. These candidate genes are involved in a broad range of biological processes including insulin signaling, juvenile hormone (JH) and ecdysteroid signaling previously shown to affect foraging behavior. Thus, here we demonstrate a causal link between Vg expression-variation and variation in the abundance of microRNAs in different tissues with possible consequences for regulation of foraging behavior.
2013-03-07 | GSE44916 | GEO