Project description:Sex differences are pervasive in human health and disease. One of the major keys to sex-biased differences lies in the sex chromosomes, which encode a group of sex-specific protein homologs. Although the functions of the X chromosome proteins are well appreciated, how they compare with their Y chromosome homologs remains elusive. One pair of sex chromosome-encoded proteins are the RNA helicases DDX3X and DDX3Y. DDX3X and DDX3Y can both form stress granules (SGs) under different types of stress. SGs are composed of a stable core structure, they are surrounded by a dynamic shell with assembly, disassembly, and transitions of proteins and RNA between the core and shell. Different SGs have distinct proteins and RNA constituents, which raises the possibility that different SGs might perform different biological functions. Previously, we performed APEX-seq to explore the RNA compositions in DDX3X and DDX3Y SGs, however, the difference between the mRNA partner of DDX3X and DDX3Y without stress treatment is still uncharted. Therefore, we applied the APEX-seq to cytosome diffused DDX3X and DDX3Y.
Project description:Although stress granules (SGs) are composed of a stable core structure, they are surrounded by a dynamic shell with assembly, disassembly, and transitions of proteins and RNA between the core and shell. Different SGs have distinct proteins and RNA constituents, which raises the possibility that different SGs might perform different biological functions. The RNA compositions of DDX3X- or DDX3Y-positive SGs are not known, nor is it known what differential effects DDX3X or DDX3Y may exert on these RNA components. To understand the biological function and the compositional differences between DDX3X- or DDX3Y-positive SGs, we first determined the RNA constituents in these SGs using an adapted Ascorbate-peroxidase (APEX)-based proximity labeling method. APEX converts exogenously supplied biotin-phenol (BP) to biotin-phenoxyl radicals, which in turn covalently labels protein and RNA in nanometers. APEX-mediated biotinylation has been widely used in studies of protein-protein interactions and recently in studying protein-RNA interactions. Here, we applied the APEX-mediated biotinylation in DDX3X and DDX3Y SGs to dissect their different RNA composition.
Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.
Project description:DDX3X is a ubiquitously expressed RNA helicase involved in multiple stages of RNA biogenesis. DDX3X is frequently mutated in Burkitt lymphoma but the functional basis for this is unknown. Here, we show that loss-of-function DDX3X mutations are also commonly found in MYC-translocated diffuse large B cell lymphoma and reveal functional co-operation between mutant DDX3X and MYC. We show that DDX3X promotes translation of mRNAs encoding components of the core translational machinery, thereby driving global protein synthesis. Loss-of-function DDX3X mutations moderate MYC-driven global protein synthesis, thereby buffering MYC-induced proteotoxic stress during early lymphomagenesis. Established lymphoma cells subsequently restore full protein synthetic capacity by ectopic expression of DDX3Y, a Y-chromosome homologue that is normally expressed exclusively in testis. These findings highlight the vulnerability of MYC-driven lymphoma to proteotoxic stress and identify an unexpected male-specific mechanism of carcinogenesis, namely the commandeering of a testis-specific Y-chromosome gene to drive full malignant transformation.
Project description:DDX3X is a ubiquitously expressed RNA helicase involved in multiple stages of RNA biogenesis. DDX3X is frequently mutated in Burkitt lymphoma but the functional basis for this is unknown. Here, we show that loss-of-function DDX3X mutations are also commonly found in MYC-translocated diffuse large B cell lymphoma and reveal functional co-operation between mutant DDX3X and MYC. We show that DDX3X promotes translation of mRNAs encoding components of the core translational machinery, thereby driving global protein synthesis. Loss-of-function DDX3X mutations moderate MYC-driven global protein synthesis, thereby buffering MYC-induced proteotoxic stress during early lymphomagenesis. Established lymphoma cells subsequently restore full protein synthetic capacity by ectopic expression of DDX3Y, a Y-chromosome homologue that is normally expressed exclusively in testis. These findings highlight the vulnerability of MYC-driven lymphoma to proteotoxic stress and identify an unexpected male-specific mechanism of carcinogenesis, namely the commandeering of a testis-specific Y-chromosome gene to drive full malignant transformation.
Project description:Transcriptome profiling of DDX3X/DDX3Y dependency after DDX3X gRNA targeting in KNS-42 parental cell lines, and rescue experiments with DDX3X or DDX3Y overexpressing cells (PACT).
Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.
Project description:To address specificity of ALaP-seq for PMLwt, we performed genome-wide profiling of genomic regions associated with NLS-APEX or PMLca-APEX. Cells were treated with H2O2 to trigger labeling of chromatin with biotin (H2O2+). Experimental negative control for PMLca (H2O2-), where the H2O2 treatment was omitted, was also analyzed.