Ontology highlight
ABSTRACT:
PROVIDER: PRJNA838954 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.
2017-03-31 | PXD004911 | Pride
Project description:Caecal microbiome metagenome of laying hens
| PRJNA291299 | ENA
Project description:Purpose: With the advent of Next-generation sequencing (NGS), several novel genes/proteins and cellular pathways in wide variety of tissues has been discovered. The aim of this study are to perform uterine transcriptome profiling (RNA-seq) to determine differently expressed genes in laying and non-laying hens and to further validate the expression of candidate genes using real-time quantitative reverse transcription polymerase chain reaction (qRT–PCR) in laying, non-laying and molting hens. Methods: Uterine mRNA profiles of 35-60 weeks-old laying and non-laying hens, three each, were generated with NextSeq 500 sequencer in single-end mode with a read length of 1x76 bp. Raw sequencing reads were cleaned and trimmmed with Prinseq tool and good reads were aligned against the chicken reference gemone (Galgal 5.0) in Array Studio. Differential gene expression analysis was performed by the DESeq2 algorithm as implemented in Array Studio. The genes with at least two-fold change (FC) and Benjamini and Hochberg q-value < 0.05 were called differentially expressed. Results: Using an optimized data analysis workflow, we mapped about 32 million reads from layers and 28 million reads from non-layers to the chicken genome. A total of 19,152 gene transcripts were annotated from Ensembl alignment which represents 50.24% of the chicken genome assembly. Differential gene expression analysis showed 616 were differentially expressed between layer and non-layer hens. 229 DEGs were significantly up-regulated and 286 were significantly down-regulated in the laying hens when compared to the non-laying hens. Twelve candiate genes, linked to calcium remodeling, were identified by gene function analysis and validated using qPCR. MEPE, CALCB, OTOP2, STC2 and ATP2C2 were confirmed to be highly expressed in laying hens as compared to molting and non-laying hens. RNA-seq and qPCR data for relative gene expression were highly correlated (R2 =0.99). Conclusions: Our study reports the expression of four novel genes that are speculated to transport calcium ions across the uterine epithellium for eggshell mineralization. These genes can be used as quantitative basis of selecting hens with an improved eggshell quality.
2018-12-06 | GSE114103 | GEO
Project description:Purpose: With the advent of Next-generation sequencing (NGS), several novel genes/proteins and cellular pathways in wide varitey of tissues has discovered. The aim of this study are to perform transcriptome profiling (RNA-seq) of magnum to determine differently expressed genes in laying and non-laying hens and to further validate the expression of candidate genes using real-time quantitative reverse transcription polymerase chain reaction (qRT–PCR) in laying, non-laying and molting hens. Methods: Magnum mRNA profiles of 35-60 weeks-old laying and non-laying hens, three each, were generated with NextSeq 500 sequencer in single-end mode with a read length of 1x76 bp. Raw sequencing reads were cleaned and trimmmed with Prinseq tool and good reads were aligned against the chicken reference gemone (Galgal 5.0) in Array Studio. Differential gene expression analysis was performed by the DESeq2 algorithm as implemented in Array Studio. The genes with at least three-fold change (FC) and Benjamini and Hochberg q-value < 0.05 were called differentially expressed. Results: Using an optimized data analysis workflow, we mapped about 30.5 million reads from layers and 33.4 million reads from non-layers to the chicken genome. A total of 19,152 gene transcripts were annotated from Ensembl alignment which represents 50.24% of the chicken genome assembly. Differential gene expression analysis showed 540 were differentially expressed between layer and non-layer hens. 152 DEGs were significantly up-regulated and 388 were significantly down-regulated in the laying hens when compared to the non-laying hens. Conclusions: Our study reports the expression of several pre-discovered and many novel genes that may be involved in the transport of precurosor molecules for biosynthesis and secretion of the egg-white proteins in the magnum. These genes can be used as quantitative basis of selecting hens with an improved egg quality.
2021-03-22 | GSE123588 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Hepatic steatosis is the initial manifestation of abnormal liver functions and often leads to liver diseases such as non-alcoholic fatty liver disease in humans and fatty liver syndrome in animals. In this study, we conducted a comprehensive analysis of a large chicken population consisting of 705 adult hens by combining host genome resequencing, liver transcriptome, proteome, and metabolome analysis, as well as microbial 16S rRNA gene sequencing of each gut segment.
2024-04-09 | PXD042451 | Pride
Project description:Laying hens Rosa 1 were immunized with two doses of DNA vaccine, based on the hemagglutinin (HA) DNA from H5N1 virus, in comparison to the control group, which was administered an empty vector (pCI). Additional groups of Rosa 1 hens were treated with one dose of above described vaccine or empty vector. Gene expression changes in the spleens of chickens were investigated at 7 day post last vaccination dose.
2020-02-29 | GSE135670 | GEO
Project description:Neonatal mice were susceptible to cryptosporidium infection at 1- and 2-weeks of age, but were resistant to infection at 3- and 6-weeks of age. Diet and microbial changes are known to occur during the weaning transition in mice and we hypothesized that these changes in the intestinal luminal environment might influence resistance and susceptibility to cryptosporidium infection. As one part of testing this hypothesis, cecal microbiota composition was determined by 16S ribosomal RNA sequencing of DNA isolated from the cecal contents of mice at 1 week, 2 weeks, 3 weeks, and 6 weeks of age.
2020-11-03 | E-MTAB-9100 | biostudies-arrayexpress
Project description:Effects of prebiotic, probiotic and synbiotic on caecal microbial diversity of laying hens
| PRJNA235148 | ENA