Escherichia virus T4
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA93685 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Genomic microarrays were used to examine the complex temporal program of gene expression exhibited by bacteriophage T4 during the course of development.The microarray data confirm the existence of distinct early, middle, and late transcriptional classes during the bacteriophage replicative cycle.This approach allows assignment of previously uncharacterized genes to specific temporal classes.The genomic expression data verify many promoter assignments and predict the existence of previously unidentified promoters. Keywords: time course
2005-11-18 | GSE3590 | GEO
Project description:Bacteriophages are highly abundant viruses of bacteria. The major role of phages in microbial ecology to shape bacterial communities and their emerging medical potential as antibacterial agents have triggered a rebirth of phage research. It is of particular interest to understand the molecular mechanisms by which phages gain control over their host. Omics technologies such as next-generation sequencing and protein-profiling technologies can provide novel insights into transcriptional and translational events occurring during the infection process. Thereby, the temporal organization of the transcriptome and proteome of the phage and their bacterial hosts can be monitored. In this study, we performed next-generation sequencing and proteomics to study the transcriptome and proteome of the T4 phage and its host during the infection in a time-resolved manner. Our data shows the temporally resolved appearance of bacteriophage T4 transcripts and proteins, confirming previously described subgrouping of T4 gene products into early, middle and late infection phases. We observe specific early transcripts giving rise to middle or late proteins indicating the existence of previously not reported post-transcriptional regulatory mechanisms controlling the translation of T4 mRNAs. Moreover, we investigated the stability of E. coli-originated transcripts and proteins in the course of infection, identifying degradation of E. coli transcripts and preservation of the host proteome. This study provides the first comprehensive insights into the transcriptomic and proteomic takeover by the bacteriophage T4, exemplifying the power and value of high-throughput technologies to simultaneously characterize multiple gene expression events. Moreover, we created a user-friendly application available to the entire scientific community to access gene expression patterns for their host and phage genes of interest.
2022-09-19 | PXD035873 | Pride
Project description:Bacteriophages are highly abundant viruses of bacteria. The major role of phages in shaping bacterial communities and their emerging medical potential as antibacterial agents has trig-gered a rebirth of phage research. To understand the molecular mechanisms by which phages hijack their host, omics technologies can provide novel insights into the organization of tran-scriptional and translational events occurring during the infection process. In this study, we ap-ply transcriptomics and proteomics to characterize the temporal patterns of transcription and protein synthesis during T4 phage infection of E. coli. We investigated the stability of E. coli-originated transcripts and proteins in the course of infection, identifying degradation of E. coli transcripts and preservation of the host proteome. Moreover, the correlation of the phage transcriptome and proteome reveals specific T4 phage mRNAs and proteins that are temporally decoupled, suggesting post-transcriptional and translational regulation mechanisms. This study provides the first comprehensive insights into the molecular takeover of E. coli by bacteriophage T4. This data set represents a valuable resource for future studies seeking to study molecular and regulatory events during infection. We created a user-friendly online tool, POTATO4, available to the scientific community to access gene expression patterns for E. coli and T4 genes.
2022-11-09 | GSE211026 | GEO
Project description:Resequencing of bacteriophage T4
| PRJEB9928 | ENA
Project description:We investigated the effect of the T4 MotB protein on E. coli gene expression. E. coli BL21 (DE3) containing either pNW129 or pNW129-MotB were grown to early log phase (OD600 ~ 0.3) then induced with 0.2% arabinose for 20 minutes. T4 phage added to the culture at MOI10. Cells were then harvested at 5 min.
2022-10-13 | PXD036347 | Pride
Project description:After the attachment of the lytic phage T4 to Escherichia coli cells, 1% E. coli cells showed an approximately 40-fold increase in mutant frequency. They were designated as mutator A global transcriptome analysis using microarrays was conducted to determine the difference between parental strain and mutators, and the host responce after adsorption of the phage and the ghost.
2018-11-29 | E-MTAB-5636 | biostudies-arrayexpress
Project description:Cyanobacteria are highly abundant in the oceans and are constantly exposed to lytic viruses. The T4-like cyanomyoviruses are abundant in the marine environment and have broad host ranges relative to other cyanophages. It is currently unknown whether broad-host-range phages specifically tailor their infection program for each host, or employ the same program irrespective of the host infected. Also unknown is how different hosts respond to infection by the same phage. Here we used microarray and RNA-seq analyses to investigate the interaction between the Syn9 T4-like cyanophage and three phylogenetically, ecologically and genomically distinct marine Synechococcus strains: WH8102, WH7803 and WH8109. Strikingly, Syn9 led a nearly identical infection and transcriptional program in all three hosts. Different to previous assumptions for T4-like cyanophages, three temporally regulated gene expression classes were observed. Furthermore, a novel regulatory element controlled early gene transcription, and host-like promoters drove middle gene transcription, different to the regulatory paradigm for T4. Similar results were found for the P-TIM40 phage during infection of Prochlorococcus NATL2A. Moreover, genomic and metagenomic analyses indicate that these regulatory elements are abundant and conserved among T4-like cyanophages. In contrast to the near-identical transcriptional program employed by Syn9, host responses to infection involved host-specific genes primarily located in hypervariable genomic islands, substantiating islands as a major axis of phage-cyanobacteria interactions. Our findings suggest that the ability of broad host-range phages to infect multiple hosts is more likely dependent on the effectiveness of host defense strategies than on differential tailoring of the infection process by the phage.
2015-11-13 | GSE74921 | GEO
Project description:Cyanobacteria are highly abundant in the oceans and are constantly exposed to lytic viruses. The T4-like cyanomyoviruses are abundant in the marine environment and have broad host ranges relative to other cyanophages. It is currently unknown whether broad-host-range phages specifically tailor their infection program for each host, or employ the same program irrespective of the host infected. Also unknown is how different hosts respond to infection by the same phage. Here we used microarray and RNA-seq analyses to investigate the interaction between the Syn9 T4-like cyanophage and three phylogenetically, ecologically and genomically distinct marine Synechococcus strains: WH8102, WH7803 and WH8109. Strikingly, Syn9 led a nearly identical infection and transcriptional program in all three hosts. Different to previous assumptions for T4-like cyanophages, three temporally regulated gene expression classes were observed. Furthermore, a novel regulatory element controlled early gene transcription, and host-like promoters drove middle gene transcription, different to the regulatory paradigm for T4. Similar results were found for the P-TIM40 phage during infection of Prochlorococcus NATL2A. Moreover, genomic and metagenomic analyses indicate that these regulatory elements are abundant and conserved among T4-like cyanophages. In contrast to the near-identical transcriptional program employed by Syn9, host responses to infection involved host-specific genes primarily located in hypervariable genomic islands, substantiating islands as a major axis of phage-cyanobacteria interactions. Our findings suggest that the ability of broad host-range phages to infect multiple hosts is more likely dependent on the effectiveness of host defense strategies than on differential tailoring of the infection process by the phage.
2015-08-30 | GSE63690 | GEO
Project description:Purpose: We investigated how deletion of DksA or ppGpp, two E. coli global transcription regulators, affects T4 infection. Method: B606, B606 DdksA, and B606 ppGpp0 were grown at 37C to early/mid log phase (OD600 ~ 0.4) then infected with moi of 10 of either wt T4 or T4motAam and total RNA was isolated. 2.5 µg total RNA from each sample was treated with a Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria; Illumina San Diego, CA) to deplete rRNA. The enriched mRNA was fragmented, reverse-transcribed, ligated with dual indexes, and amplified using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). The resulting RNA-Seq libraries were pooled at equal concentrations and sequenced using on an Illumina MiSeq to generate 2 x 100 bp paired-end reads. Read data in fastq format was demultiplexed and aligned to E. coli B str. DE3 (NC_012971.2) reference genome using STAR v2.5.2, retaining unmapped reads (Dobin, Davis et al. 2013). Unmapped reads were then mapped in a second step to T4 reference (NC_000866.4). In both cases, default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1. RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package (Liao, Smyth et al. 2014). Differential expression between samples fchanges in gene expression was predetermined to entail a fold change of more than or equal to 2 and P value less than or equal to 0.05. at 5 minutes post-infection. Result: Both ppGpp0 and delta(dksA) increase wt T4 plaque size. However, ppGpp0 does not significantly alter burst size/latent period and only modestly affects T4 transcript abundance, while delta(dskA) increases burst size (2-fold), does not affect latent period, and increases the abundance of several Pe RNAs at 5 min post-transcription. delta(dskA) also increases T4motAam plaque size with a much shorter latent period compared to T4motAam/wt infection, and the levels of specific middle RNAs increase due to more transcription from Pe's that extend into these middle genes. Conclusion: We conclude that DksA attenuates T4 early gene expression. Consequently, delta(dksA) results in a more productive wt infection and ameliorates the poor expression of middle genes in a T4motAam infection.
2018-03-15 | GSE111808 | GEO
Project description:The mechanisms by which viruses hijack their host’s genetic machinery are of current interest. When bacteriophage T4 infects Escherichia coli, three different ARTs (ADP-ribosyltransferases) reprogram the host’s transcriptional and translational apparatus 1,2 through ADP-ribosylation using nicotinamide adenine dinucleotide (NAD) as substrate. Recently, NAD was identified as a 5’-modification of cellular RNAs 3-5. Here, we report that the bacteriophage T4 ART ModB accepts not only NAD but also NAD-capped RNA (NAD-RNA) as substrate, linking entire RNA chains to acceptor proteins in an “RNAylation” reaction. We discovered that ModB specifically RNAylates ribosomal proteins rS1 and rL2. By mass spectrometric (MS) analysis we identified arginine residues of rS1 and rL2 as RNAylation sites. Furthermore, we identified specific E. coli and T4 phage RNAs, which are covalently linked to rS1 in vivo. T4 phages expressing an inactive mutant of ModB show a decreased burst size and a decelerated lysis of E. coli during T4 infection. The attachment of specific RNAs to ribosomal proteins might provide a strategy for the phage to modulate the host’s translation machinery. Our findings reveal a distinct biological role of NAD-RNA, namely activation of the RNA for enzymatic transfer. This work exemplifies the first direct connection between RNA modification and post-translational protein modification. As ARTs play important roles far beyond viral infections 6, RNAylation may have far-reaching implications.
2023-06-01 | PXD038910 | Pride