Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Characterizing dermokine isoforms in human epidermal equivalents

ABSTRACT: The epidermis provides a vital barrier between the human body and its external environment, playing critical roles in protection, water retention, and mechanical resistance. Dermokine, a secreted protein produced by suprabasal keratinocytes, is associated with epidermal stratification and terminal differentiation. However, its function has been poorly understood, in part due to its multiple isoforms – dermokine-α, dermokine-β, and dermokine-γ, each with unique domain architectures that contribute to diverse biological processes. In this study, we utilized human skin organoids, which allowed us to monitor epidermal stratification at endogenous dermokine isoform levels using wildtype in comparison to Dmkn αβ-/- and Dmkn βγ-/- keratinocytes. Our results identified that isoform-specific ablation of dermokine led to a disrupted suprabasal stratification detectable both in the histological assessment and various proteomics methods using a human system. By integrating this information, we corroborate that dermokine is involved in the suprabasal epidermal stratification and indirectly influences the abundance of proteins associated with the assembly of the cornified envelope including epidermal proteases.

ORGANISM(S): Homo Sapiens

SUBMITTER: Vahap Canbay

PROVIDER: PXD055801 | panorama | Fri Apr 10 00:00:00 BST 2026

REPOSITORIES: PanoramaPublic

ACCESS DATA

Json Xml

Similar Datasets

Epidermal barrier impairment predisposes for excessive growth of the allergy-associated yeast Malassezia on murine skin

Project description:The skin barrier is vital for protection against environmental threats including insults caused by skin-resident microbes. Dysregulation of this barrier is a hallmark of atopic dermatitis (AD) and ichthyosis, with variable consequences for host immune control of colonizing commensals and opportunistic pathogens. While Malassezia is the most abundant commensal fungus of the skin, little is known about the host control of this fungus in inflammatory skin diseases. Here we show that in barrier-impaired skin, Malassezia acquires enhanced fitness and overt growth properties. By using four distinct and complementary murine models of atopic dermatitis and ichthyosis we provide evidence that structural and metabolic changes in the dysfunctional epidermal barrier environment provide increased accessibility and an altered lipid profile, to which the lipid-dependent yeast adapts for enhanced nutrient assimilation. These findings reveal fundamental insights into the implication of the mycobiota in the pathogenesis of common skin barrier disorders.

2024-02-20 | GSE253214 | GEO

Transcription profiling of human cells embryonic kidney cells (HEK 293 cell line) overexpressing different isoforms of hIMP1 protein

Project description:Regulation of presenilin genes. Presenilins are intramembrane aspartic proteases. These proteases are critical proteins in pathogenesis of Alzheimer's disease. The function of recently identified presenilin-homologous proteases (IMPAS or SPP)s is unknown. Our preliminary data in C.elegans model suggested the role of these proteins in early-development and , perhaps, in pathway related- to cholesterol -regulated signalling (Grigorenko et al, 2004, PNAS). The overall goal is to determine pattern of gene expression alterations in cells with knock-out or knock-down presenilin related proteins (IMPAS). The cultured cells, C.elegans and mouse models are planned to be used in this study. Initially, we will determine gene expression patterns in human cells embryonic kidney cells (HEK 293 cell line) overexpressing different isoforms of hIMP1 protein. We hypothesize that novel family of presenilin-related proteases is important for cholesterol-regulated intracellular signalling and early development (including CNS/neuronal development and function). We will examine in HEK 293 cells effect of over expression of 1) hIMP1 wt protein, 2) over expression of dominant negative isoform of hIMP1 protein and compare their gene expression patterns to 3) HEK 293 cells treated with mock vector. HEK 293 cells were seeded on 10 cm plates and transfected next day using Lipofectamine Plus reagent. 24 hours after cells were washed twice with ice cold PBS buffer and lysed with TRizol reagent directly on plates. Total RNA was extracted, purified according the manufacturer protocol and stored at -800C. We will provide 2 RNA samples for each hIMP1 isoform used in two different transfection experiment to reduce any spurious expression differences resulting from culture condition or transfection efficiency variations.

2008-06-14 | E-GEOD-6276 | biostudies-arrayexpress

Title: Demographic Factors Predictive of Skin Barrier Function in a Large Population-Based Study

Project description:The skin has a vital role in homeostasis, but there are limited and conflicting data on factors associated with skin barrier function. We evaluated the relationship between participant characteristics and four barrier function measures in a diverse population-based sample of 286 participants ages 32-97 in the Baltimore Longitudinal Study of Aging (BLSA), a well-characterized cohort of healthy aging. Multivariable analysis indicated older age, female sex, Black race/ethnicity, and higher BMI were associated with at least one measure of better barrier function: older age was associated with better dynamic barrier function (beta=-0.141, p=0.034) and barrier permeability (beta=-0.158, p=0.018); female participants had superior dynamic barrier function (beta=0.164, p=0.027) and increased barrier recovery (beta=-0.239, p=0.001); black participants also had better dynamic barrier function (beta=-0.200, p=0.006) and higher barrier integrity (beta=0.256, p<0.001); and higher BMI was associated with better barrier integrity (beta=0.131, p=0.033). Protein expression from tape strips analyzed by mass spectrometry among a sub-sample of 20 participants showed that protein families linked to barrier composition and insult response were higher among participants with above-median barrier function (p<0.01). Our results provide a framework for future research on epidermal barrier function and suggest additional measures are needed to differentiate age-associated barrier decline.

2025-05-08 | MSV000097834 | MassIVE

Regulation of MYC by CARD14 in Human Epithelium is a Determinant of Epidermal Homeostasis and Disease II

Project description:Caspase recruitment domain family member 14 (CARD14) and its variants are associated with both atopic dermatitis (AD) and psoriasis, but their mechanistic impact on skin barrier homeostasis is largely unknown. CARD14 is known to signal via NFκB, however, CARD14-NFκB signaling does not fully explain the heterogeneity of CARD14-driven disease. Herein, we describe a direct interaction between CARD14 and MYC and show that CARD14 signals through MYC in keratinocytes to coordinate skin barrier homeostasis. CARD14 directly binds MYC and influences barrier formation in a MYC-dependent fashion, and this mechanism is undermined by disease-associated CARD14 variants. These studies establish a paradigm that CARD14 activation regulates skin barrier function by two distinct mechanisms including activating NFκB to bolster the antimicrobial (chemical) barrier and stimulating MYC to bolster the physical barrier. Finally, we show that CARD14-dependent MYC signaling occurs in other epithelia expanding the impact of our findings beyond the skin.

2024-07-13 | GSE263428 | GEO

Regulation of MYC by CARD14 in Human Epithelium is a Determinant of Epidermal Homeostasis and Disease I

2024-07-13 | GSE263420 | GEO

Dual Gene Expression Analysis Identifies Factors Associated with Staphylococcus aureus Virulence in Diabetic Mice

Project description:Staphylococcus aureus is a major human pathogen of the skin. The global burden of diabetes is high, with S. aureus being a major complication of diabetic wound infections. We investigated how the diabetic environment influences S. aureus skin infection and observed an increased susceptibility to infection in mouse models of both type I and type II diabetes. A dual gene expression approach was taken to investigate transcriptional alterations in both the host and bacterium after infection. While analysis of the host response revealed only minor changes between infected control and diabetic mice, we observed that S. aureus isolated from diabetic mice had significant increases in the levels of genes associated with translation and posttranslational modification and chaperones and reductions in the levels of genes associated with amino acid transport and metabolism. One family of genes upregulated in S. aureus isolated from diabetic lesions encoded the Clp proteases, associated with the misfolded protein response. The Clp proteases were found to be partially glucose regulated as well as influencing the hemolytic activity of S. aureus Strains lacking the Clp proteases ClpX, ClpC, and ClpP were significantly attenuated in our animal model of skin infection, with significant reductions observed in dermonecrosis and bacterial burden. In particular, mutations in clpP and clpX were significantly attenuated and remained attenuated in both normal and diabetic mice. Our data suggest that the diabetic environment also causes changes to occur in invading pathogens, and one of these virulence determinants is the Clp protease system.

2024-08-02 | GSE242845 | GEO

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.

2016-01-11 | GSE69352 | GEO

Single-molecule, full-length transcript isoform sequencing reveals disease-associated RNA isoforms

Project description:Alternative splicing generates differing RNA isoforms that govern phenotypic complexity of eukaryotes. Its malfunction underlies many diseases, including cancer and cardiovascular diseases. Comparative analysis of RNA isoforms at the genome-wide scale has been difficult. Here, we established an experimental and computational pipeline that accurately quantifies transcript isoforms in their entire length from cDNA sequences with a full-length isoform detection accuracy of 97.6%. We generated a searchable, quantitative human transcriptome annotation with 31,025 known and 5,740 novel transcript isoforms (http://steinmetzlab.embl.de/iBrowser/). By analyzing the isoforms in the presence of RNA Binding Motif Protein 20 (RBM20) mutations associated with aggressive dilated cardiomyopathy (DCM), we identified 121 differentially expressed transcript isoforms in 107 cardiac genes. By establishing an isoform-differential expression test, our approach revealed that 11 of these genes displayed no detectable change in overall RNA expression. However, significant differences in the expression of specific isoforms in these genes was observed. These isoform specific effects demonstrate the need of analyzing RNA isoform expression levels rather than total gene expression levels.

2021-06-16 | E-MTAB-7334 | biostudies-arrayexpress

NFAT5 Controls the Integrity of Skin II

Project description:The skin protects the human body against dehydration and harmful challenges. Keratinocytes (KCs) are the most frequent epidermal cells, and it is anticipated that KC-mediated transport of Na+ ions creates a physiological barrier of high osmolality against the external environment. We studied in KCs the role of NFAT5, a transcription factor whose activity is controlled by osmotic stress. Cultured KCs from adult mice secrete more than 300 proteins, and upon NFAT5 ablation, the secretion of several matrix proteinases, including metalloproteinase-3 (Mmp3) and kallikrein-related peptidase 7 (Klk7), was markedly enhanced. An increase in Mmp3 and Klk7 RNA levels was also detected in transcriptomes of Nfat5-/- KCs, along with increases of numerous components of ‘Epidermal Differentiation Complex’ (EDC), as proline-rich Sprr and S100 proteins. NFAT5 and Mmp3 are co-expressed in basal KCs from fetal and adult skin but not in skin of newborn mice. This is correlated with a strong increase in Mmp3 and Klk7 expression in KCs of newborn mice and suggests, along with the fragile epidermis of adult Nfat5-/- mice, a suppressive effect of NFAT5 on the expression of matrix proteases in skin. Our data suggest that NFAT5 controls the expression of matrix proteases in skin and contributes to the many fold changes during embryonal skin development and skin integrity in adults.

2021-12-29 | GSE184179 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data