Quantitative measurement of full-length transcript isoforms reveals precise regulation of splicing in human heart cells
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB29366 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR2856510.fastq.gz | Fastqsanger.gz | |||
| ERR2856520.fastq.gz | Fastqsanger.gz | |||
| ERR2856511.fastq.gz | Fastqsanger.gz | |||
| ERR2856512.fastq.gz | Fastqsanger.gz | |||
| ERR2856513.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 13 |
Similar Datasets
Project description:Alternative splicing generates differing RNA isoforms that govern phenotypic complexity of eukaryotes. Its malfunction underlies many diseases, including cancer and cardiovascular diseases. Comparative analysis of RNA isoforms at the genome-wide scale has been difficult. Here, we established an experimental and computational pipeline that accurately quantifies transcript isoforms in their entire length from cDNA sequences with a full-length isoform detection accuracy of 97.6%. We generated a searchable, quantitative human transcriptome annotation with 31,025 known and 5,740 novel transcript isoforms (http://steinmetzlab.embl.de/iBrowser/). By analyzing the isoforms in the presence of RNA Binding Motif Protein 20 (RBM20) mutations associated with aggressive dilated cardiomyopathy (DCM), we identified 121 differentially expressed transcript isoforms in 107 cardiac genes. By establishing an isoform-differential expression test, our approach revealed that 11 of these genes displayed no detectable change in overall RNA expression. However, significant differences in the expression of specific isoforms in these genes was observed. These isoform specific effects demonstrate the need of analyzing RNA isoform expression levels rather than total gene expression levels.
2021-06-16 | E-MTAB-7334 | biostudies-arrayexpress
Project description:Precise Transcript Reconstruction with End-Guided Assembly
| PRJNA783213 | ENA
Project description:Accurate annotation of transcript isoforms is crucial to understand gene functions, but automated methods for reconstructing full-length transcripts from RNA sequencing (RNA-seq) data remain imprecise. We developed Bookend, a software package for transcript assembly that incorporates data from different RNA-seq techniques, with a focus on identifying and utilizing RNA 5′ and 3′ ends. Through end-guided assembly with Bookend we demonstrate that correct modeling of transcript start and end sites is essential for precise transcript assembly. Furthermore, we discovered that utilization of end-labeled reads present in full-length single-cell RNA-seq (scRNA-seq) datasets dramatically improves the precision of transcript assembly in single cells. Finally, we show that hybrid assembly across short-read, long-read, and end-capture RNA-seq datasets from Arabidopsis, as well as meta-assembly of RNA-seq from single mouse embryonic stem cells (mESCs) can produce end-to-end transcript annotations of comparable quality to reference annotations in these model organisms.
2022-01-08 | GSE189482 | GEO
Project description:Precise measurement of molecular phenotypes with barcode-based CRISPRi screens
| PRJNA1118732 | ENA
Project description:We report isoCirc, a long-read sequencing strategy coupled with an integrated computational pipeline to characterize full-length circular RNA (circRNA isoforms) using rolling circle amplification (RCA) followed by long-read sequencing. Applying isoCirc to 12 human tissues, we determined full-length structures and examined tissue specificities of circRNA isoforms in human transcriptomes.
2020-09-12 | GSE141693 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:Circular RNAs (circRNAs) have been found abundantly expressed in cancer. Their resistance to exonucleases enables them to have potentially stable interactions with with different types of biomolecules. Alternative splicing can create different circRNA isoforms that have different sequences and unequal interaction potentials. The study of circRNA function thus requires knowledge of complete circRNA sequences. Here we describe psirc, a method that can identify full-length circRNA isoforms and quantify their expression levels using RNA sequencing data. We confirm the effectiveness and computational efficiency of psirc using both simulated and actual experimental data. Applying psirc on transcriptome profiles from nasopharyngeal carcinoma and normal nasopharynx samples, we discovered circRNA isoforms differentially expressed between the two groups. Compared to the assumed circular isoforms derived from linear transcript annotations, some of the alternatively spliced circular isoforms have 100 times higher expression and contain fewer microRNA response elements, demonstrating the importance of quantifying full-length circRNA isoforms.
2021-04-06 | GSE165181 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:Alternative splicing generates differing RNA isoforms that govern phenotypic complexity of eukaryotes. Its malfunction underlies many diseases, including cancer and cardiovascular diseases. Comparative analysis of RNA isoforms at the genome-wide scale has been difficult. Here, we establish an experimental and computational pipeline that performs de novo transcript annotation and accurately quantifies transcript isoforms from cDNA sequences with a full-length isoform detection accuracy of 97.6%. We generate a searchable, quantitative human transcriptome annotation with 31,025 known and 5,740 novel transcript isoforms ( http://steinmetzlab.embl.de/iBrowser/ ). By analyzing the isoforms in the presence of RNA Binding Motif Protein 20 (RBM20) mutations associated with aggressive dilated cardiomyopathy (DCM), we identify 121 differentially expressed transcript isoforms in 107 cardiac genes. Our approach enables quantitative dissection of complex transcript architecture instead of mere identification of inclusion or exclusion of individual exons, as exemplified by the discovery of IMMT isoforms mis-spliced by RBM20 mutations. Thereby we achieve a path to direct differential expression testing independent of an existing annotation of transcript isoforms, providing more immediate biological interpretation and higher resolution transcriptome comparisons.
| S-EPMC8270901 | biostudies-literature
Project description:isoCirc catalogs full-length circular RNA isoforms in human transcriptomes
| PRJNA594380 | ENA