Phenotypic evidence of deltamethrin resistance and identification of selective sweeps in Anopheles mosquitoes on the Bijagós Archipelago, Guinea-Bissau
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB71957 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR12644916_1.fastq.gz | Fastqsanger.gz | |||
| ERR12644916_2.fastq.gz | Fastqsanger.gz | |||
| ERR12644917_1.fastq.gz | Fastqsanger.gz | |||
| ERR12644917_2.fastq.gz | Fastqsanger.gz | |||
| ERR12644918_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 86 |
Similar Datasets
Project description:Vector control in the Bijagós Archipelago of Guinea-Bissau currently relies on pyrethroid insecticide-treated nets. However, data on insecticide resistance in Guinea-Bissau is limited. This study identified deltamethrin resistance in the Anopheles gambiae sensu lato complex on Bubaque island using WHO tube tests in November 2022. Whole genome sequencing of An. gambiae sensu stricto mosquitoes identified six single nucleotide polymorphisms (SNPs) previously associated with, or putatively associated with, insecticide resistance: T791M, L995F, N1570Y, A1746S and P1874L in the vgsc gene, and L119V in the gste2 gene. Twenty additional non-synonymous SNPs were identified in insecticide-resistance associated genes. Four of these SNPs were present at frequencies over 5% in the population: T154S, I126F and G26S in the vgsc gene and A65S in ace1. Genome wide selection scans using Garud's H12 statistic identified two selective sweeps: one in chromosome X and one in chromosome 2R. Both selective sweeps overlap with metabolic genes previously associated with insecticide resistance, including cyp9k1 and the cyp6aa/cyp6p gene cluster. This study presents the first phenotypic testing for deltamethrin resistance and the first whole genome sequence data for Anophelesgambiae mosquitoes from the Bijagós, contributing data of significance for vector control policy in this region.
| S-EPMC11445403 | biostudies-literature
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test
2012-10-01 | GSE39269 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:we report the RNA-seq based analyses of the transcriptional changes in the Anopheles gambiae mosquitoes from East Africa classified as deltamethrin-resistant or -suscpetible accordign the WHO test comparison of the transcriptome of Anopheles gambiae mosquitoes with phenotypically resistant or suscpetible to deltamethrin
2012-10-01 | E-GEOD-39269 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Overall, the study aims at obtaining a comprehensive picture of the African malaria mosquito, Anopheles gambiae, transcriptome using high-coverage RNA-seq of sexed whole-insect samples collected at different developmental time points. This experiment focuses on transcriptomes of 1st, 2nd, 3rd and 4th instar male and female larvae, and 2 day old male and female adults.
2015-04-01 | E-MTAB-2527 | biostudies-arrayexpress
Project description:Malaria causes more than 300 million clinical cases and 665,000 deaths each year, and the majority of the mortality and morbidity occurs in sub-Saharan Africa. Due to the lack of effective vaccines and wide-spread resistance to antimalarial drugs, mosquito control is the primary method of malaria prevention and control. Currently, malaria vector control relies on the use of insecticides, primarily pyrethroids. The extensive use of insecticides has imposed strong selection pressures for resistance in the mosquito populations. Consequently, resistance to pyrethroids in Anopheles gambiae, the main malaria vector in sub-Saharan Africa, has become a major obstacle for malaria control. A key element of resistance management is the identification of resistance mechanisms and subsequent development of reliable resistance monitoring tools. Field-derived An. gambiae from Western Kenya were phenotyped as deltamethrin-resistant or -susceptible by the standard WHO tube test, and their expression profile compared by RNA-seq. Based on the current annotation of the An. gambiae genome, a total of 1,093 transcripts were detected as significantly differentially accumulated between deltamethrin-resistant and -susceptible mosquitoes. These transcripts are distributed over the entire genome, with a large number mapping in QTLs previously linked to pyrethorid resistance, and correspond to heat-shock proteins, metabolic and transport functions, signal transduction activities, cytoskeleton and others. The detected differences in transcript accumulation levels between resistant and susceptible mosquitoes reflect transcripts directly or indirectly correlated with pyrethroid resistance. RNA-seq data also were used to perform a de-novo Cufflinks assembly of the An. gambiae genome.
| S-EPMC3436877 | biostudies-literature
Project description:We custom-built a bioinformatics pipeline to search for 20E-modifying enzymes in the accessory glands of Anopheles gambiae males, searching for ecdysteroid kinases (EcK), ecdysone oxidases (EO), and ecdysteroid-phosphate phosphatases (EPP). To this end, we generated RNAseq datasets of different An. gambiae tissues dissected from virgin and mated females and males, and produced similar datasets for Anopheles albimanus, a South American species that does not synthetize and transfer ecdysteroids during mating. These analyses led to the identification of one candidate EPP and two potential EcKs (EcK1 and EcK2), which we demonstrated are involved in the activity of a male-specific oxidized ecdysteroid (3D20E). We further determined that 3D20E is specifically produced by the An. gambiae male accessory glands and is transferred to females during copulation, where it triggers a series of post-mating responses.
2022-04-20 | GSE198665 | GEO
Project description:Proteomic analysis of Anopheles gambiae brain tissue after in-gel trypsin digestion. To gain insights into neurobiology of the Anopheles gambiae mosquito, we carried out a proteomic analysis of its brain using a comprehensive proteomic approach.
2016-12-20 | PXD000630 | Pride
Project description:The mechanisms by which mosquitoes survive the desiccating conditions of the dry season in West African savannahs and are able to readily transmit malaria as soon as the rains start remain largely unknown. Thus, we examined the degree to which the physiology of 1 h- and 24 h-old female An. gambiae M and S is altered at the onset of the dry season (“ods”) by examining their metabolic fingerprints and protein expression, which were compared to those of females exposed to the rainy season (“rs”) conditions. Three amino acids (phenylalanine, tyrosine and valine) that play a pivotal role in cuticle hardness were significantly decreased from the 1 h- to 24 h-old females, regardless of the experimental conditions. These amino acids were present in higher amounts in 1 h-old female An. gambiae M reared under “ods”; such a seasonal difference was not reported in the female S molecular form. Together with the increased expression of cuticular proteins 70 and 117(spots 67 and 65, respectively), our data suggest that the cuticle thickness, rigidity and permeability were adjusted at the onset of the dry season. Evident signs of energetic metabolism adjustments were found in both of the molecular forms at the onset of the dry season. Moreover, 1 h-old females of An. gambiae S were characterised by elevated amounts of glycogen phosphorylase, isocitrate dehydrogenase and citrate synthase, suggesting an increase of their metabolic activity at the onset of the dry season. This study presents novel insights into drought resistance in the mosquitoes of utmost medical importance.
2014-09-03 | PXD000294 | Pride