The AsiDNA™ decoy mimicking DSBs protects the normal tissue from radiation toxicity through a DNA-PK/p53/p21-dependent G1/S arrest.
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1003948 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR25591676_1.fastq.gz | Fastqsanger.gz | |||
| SRR25591676_2.fastq.gz | Fastqsanger.gz | |||
| SRR25591677_1.fastq.gz | Fastqsanger.gz | |||
| SRR25591677_2.fastq.gz | Fastqsanger.gz | |||
| SRR25591678_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 6 |
Similar Datasets
Project description:AsiDNA, a cholesterol-coupled oligonucleotide mimicking double-stranded DNA breaks, was developed to sensitize tumour cells to radio- and chemotherapy. This drug acts as a decoy hijacking the DNA damage response. Previous studies have demonstrated that standalone AsiDNA administration is well tolerated with no additional adverse effects when combined with chemo- and/or radiotherapy. This lack of normal tissue complication encouraged further examination into the role of AsiDNA in normal cells. The delayed development of pulmonary fibrosis after FLASH-RT compared to CONV-RT might be a known phenomenon but the complexity behind this specific tissue response is completely unidentified. Radiation has been shown to impact various cell types presented in the lung, resulting in changes in cellular activity and numerous pathway activations. Current unpublished data suggest a clear variety between the CONV and FLASH-RT gene signatures examined using single cell RNA sequencing. As the combined treatment of AsiDNA with CONV-RT resulted in a delay in radiation induced lung fibrosis compared to CONV-RT standalone, it is to be questioned if the signature of AsiDNA CONV-RT is similar to FLASH-RT or CONV-RT. To characterize the similarity in cellular changes and expression signatures in lungs 5 months post CONV-RT, FLASH-RT, AsiDNA CONV-RT or non-irradiated (Control) treatment. Single cell RNA sequencing of irradiated lungs revealed a closer resemblance between CONV AsiDNA and FLASH-RT in profibrotic gene signatures within the fibroblast and macrophages population, in comparison to CONV-RT standalone. Collectively, this information indicates that the activity of AsiDNA and FLASH-RT could draw upon identical mechanism interference to result in the protective capacities within the normal tissue.
2024-02-27 | GSE240510 | GEO
Project description: Not available
| S-EPMC10928987 | biostudies-literature
Project description:An effective long-term inhibition of multiple DNA repair signals is required to design a novel and effective therapeutic for glioblastoma (GBM), a highly DNA repair ‘addicted’ cancer. AsiDNA, a double-strand DNA break (DSB) mimetic, is an innovative approach that shuts down the entire DNA repair system in cancer cells by sequestering DSB repair factors. We showed that inhibition of class I histone deacetylases (HDACs) dislodges repair factors from sites of DNA damage. We therefore tested whether AsiDNA and pan HDAC inhibitor Belinostat combination can impart a chromatin-based long-term DNA damage and impair DNA repair in GBM cells. We performed mass spectrometry with chromatin isolated from AsiDNA and Belinostat and found that Belinostat reduces histone H1.2 levels. To this end, we assessed whether AsiDNA and Belinostat alter histone H1.2 occupancy genome-wide. In order to understand the long-term effects of AsiDNA on DNA repair, we treated U87 cells with AsiDNA for 6 days followed by 6 days recovery from the drug. We used this protocol to create long-term AsiDNA treated cells (LTAU87) according to the clinical trial protocol. We performed H1.2 ChIP-Seq with LTAU87 cells and MTU87 (mock treated U87; control) in the presence and absence of belinostat in order to address whether they alter the global chromatin structure.
2024-05-13 | GSE266619 | GEO
Project description:Transcriptome analysis revealed a major change in gene expression with a large excess of genes down regulated in 3 independent AsiDNA-treated “evolved” populations as compared to three independent not-treated “naïve” populations The Achilles heel of anticancer treatments is intrinsic or acquired resistance. Among many targeted therapies, the DNA repair inhibitors show limited efficacy due to rapid emergence of resistance. We examined evolution of cancer cells and tumors treated with AsiDNA, a new DNA repair inhibitor targeting all DNA break repair pathways. Effects of AsiDNA or Olaparib were analyzed in various cell lines. Frequency of AsiDNA- and olaparib-resistant clones was measured after 2 weeks of continuous treatment in KBM7 haploid cells. Cell survivals were also measured after one to six cycles of 1-week treatment and 1-week recovery in MDA-MB-231 and NCI-H446. Transcriptomes of cell populations recovering from cyclic treatments or mock treatment were compared. MDAMB- 231 xenografted models were treated with three cycles of AsiDNA to monitor the effects of treatment on tumor growth and transcriptional modifications. No resistant clones were selected after AsiDNA treatment (frequency b 3x10−8) in treatment conditions that generate resistance to olaparib at a frequency of 7.2x10−7 resistant clones per treated cell. Cyclic treatments promote cumulative sensitivity characterized by a higher mortality of cells having undergone previous treatment cycles. This sensitization was stable, and transcriptome analysis revealed a major gene downregulation with a specific overrepresentation of genes coding for targets of DNA-PK. Such changes were also detected in tumor models which showed impaired growth after cycles of AsiDNA treatment.
2020-08-20 | GSE144023 | GEO
Project description:An effective long-term inhibition of multiple DNA repair signals is required to design a novel and effective therapeutic for glioblastoma (GBM), a highly DNA repair ‘addicted’ cancer. AsiDNA, a double-strand DNA break (DSB) mimetic, is an innovative approach that shuts down the entire DNA repair system in cancer cells by sequestering DSB repair factors. We showed that inhibition of class I histone deacetylases (HDACs) dislodges repair factors from sites of DNA damage. We therefore tested whether AsiDNA and pan HDAC inhibitor Belinostat combination can impart a chromatin-based long-term DNA damage and impair DNA repair in GBM cells. We performed mass spectrometry with chromatin isolated from AsiDNA and Belinostat and found that Belinostat reduces histone H1.2 levels. To this end, we assessed whether AsiDNA and Belinostat alter histone H1.2 occupancy genome-wide. In order to understand the long-term effects of AsiDNA on DNA repair, we treated U87 cells with AsiDNA for 6 days followed by 6 days recovery from the drug. We used this protocol to create long-term AsiDNA treated cells (LTAU87) according to the clinical trial protocol. We performed NicE-seq with LTAU87 cells and MTU87 (mock treated U87; control) in the presence or absence of belinostat treatment in order to address whether they alter the global chromatin structure.
2024-05-13 | GSE266621 | GEO
Project description:An effective long-term inhibition of multiple DNA repair signals is required to design a novel and effective therapeutic for glioblastoma (GBM), a highly DNA repair ‘addicted’ cancer. AsiDNA, a double-strand DNA break (DSB) mimetic, is an innovative approach that shuts down the entire DNA repair system in cancer cells by sequestering DSB repair factors. We showed that inhibition of class I histone deacetylases (HDACs) dislodges repair factors from sites of DNA damage. We therefore tested whether AsiDNA and pan HDAC inhibitor Belinostat combination can impart a chromatin-based long-term DNA damage and impair DNA repair in GBM cells. In order to understand the long-term effects of AsiDNA on DNA repair, we treated U87 cells with AsiDNA for 6 days followed by 6 days recovery from the drug. We used this protocol to create long-term AsiDNA treated cells (LTAU87) according to the clinical trial protocol. We performed RNA-Seq with LTAU87 cells and MTU87 (mock treated U87; control) in the presence and absence of belinostat.
2024-05-13 | GSE266620 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:MicroRNA-10b may target numerous genes in gliomagenesis. The target genes of miR-10b may differ according to the cellular context. We used microarray analyses to determine the phenotypic effects and gene targets of miR-10b by silencing miR-10b in invasive U87-2M1 glioma cells. Early passage U87-2M1 cells treated with the baculoviral control decoy vector or miR-10b decoy vector were selected for RNA extraction and hybridization on microarray
2012-12-31 | E-GEOD-35170 | biostudies-arrayexpress
Project description:Conventional Intestinal organoids such as those supported by IntestiCult™ Organoid Growth medium (Human) often fail to recapitulate the cellular diversity of the intestinal epithelium and are typically comprised of Lgr5+ stem cells, transit amplifying cells, but few other cell types. IntestiCult™ Plus Organoid Growth Medium is designed to support both the expansion and differentiation of primary human intestinal organoids. Here we sought to compare the cellular diversity and transcriptomic profiles of primary organoids from 3 intestinal regions of a single donor, expanded with both IntestiCult™ OGM (Human) and IntestiCult™ Plus.
2025-09-22 | GSE308421 | GEO