Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Project description:The success of Enterococcus faecium and E. faecalis evolving as multi-resistant nosocomial pathogens is associated with their ability to acquire and share adaptive traits, including mobile genetic elements (MGE) encoding antimicrobial resistance. Here, we define the mobilome in representative successful hospital associated genetic lineages, E. faecium ST17 (n=10) and ST78 (n=10), E. faecalis ST6 (n=10) and ST40 (n=10) using DNA microarray analyses. The hybridization patterns of 272 targets representing plasmid backbones (n=85), transposable elements (n=85), resistance determinants (n=67), prophages (n=29), and CRISPR-cas sequences (n=6) separated the strains according to species, and for E. faecalis also according to STs. Although plasmids belonging to the RCR-, Rep_3-, RepA_N- and Inc18-families were well represented with no significant differences in prevalence, the presence of specific replicon classes differed highly between the species; E. faecium was dominated by rep17/pRUM, rep2/pRE25, rep14/EFNP1 and rep20/pLG1 and E. faecalis by rep9/pCF10, rep2/pRE25 and rep7. Tn916-elements conferring tetracycline resistance (tetM) were found in all E. faecalis strains, but only in two E. faecium strains. A significant higher prevalence of IS256-, IS3-, ISL3-, IS200/IS605-, IS110-, IS982-, and IS4-transposases were detected in E. faecium, and of IS110-, IS982- and IS1182-transposases in E. faecalis ST6 compared to ST40. Notably, the transposases of IS981, ISEfm1 and IS1678 which have only been reported in few enterococcal isolates, were well represented in the E. faecium strains. E. faecalis ST40 strains harboured possible functional CRISPR-Cas systems, and still resistance and prophage sequences were generally well represented. Gene targets defined as the enterococcal mobilome, including plasmids, IS elements and transposons, resistance determinants, prophage sequences and CRISPR-Cas systems were highly prevalent, underlining their potential importance in the evolution of hospital associated STs. An association between axe-txe to the RepA_N-family and M-OM-^I-M-NM-5-M-NM-6 to the Inc18-family, implicates the contribution of TA-systems in stable plasmid maintenance carrying virulence and resistance determinants in enterococci. The concurrent presence of defined MGE and their associated resistance markers was generally confirmed and illustrates the importance of horizontal gene transfer in the development of multidrug resistant enterococci. All together 272 DNA targets representing mobile genetic elements and antimicrobial resistance determinants associated with enterococci were spotted on a CustomArray 4x2K microarray from CustomArray Inc. Each fourplex microarray slide contain four identical sectors that were stripped and re-hybridized up to six times. Each target was represented by 1-5 probes each. The total of 1250 probes were Tm balanced by altering their lenght between 35 and 40 nucleotides. Total DNA of 41 samples were hybridized and a control strain, the fully sequenced E. faecalis V585, was included in one of the four sectors on each slide in each set of hybridization to monitor the overall array and hybridization quality.

Project description:CRISPR-Cas immune systems function to defend prokaryotes against potentially harmful mobile genetic elements including viruses and plasmids. The multiple CRISPR-Cas systems (Types I, II, III) each recognize and target destruction of foreign invader nucleic acids via structurally and functionally diverse effector complexes (crRNPs). CRISPR-Cas effector complexes are comprised of CRISPR RNAs (crRNAs) that contain sequences homologous to the invading nucleic acids and Cas proteins specific to each immune system type. We have previously characterized a crRNP in Pyrococcus furiosus (Pfu) that contains Cmr proteins (Type III-B) associated with one of two primary size forms of crRNAs and functions through homology-dependent cleavage of target RNAs. In the current study, we have isolated and characterized two additional native Pfu CRISPR-Cas complexes containing either Csa (Type I-A) or Cst (Type I-G) proteins and distinct profiles of associated crRNAs. For each complex, the Cas proteins were identified by tandem mass spectrometry and immunoblotting and the crRNAs by RNA deep sequencing and Northern blot analysis. The crRNAs associated with both the Csa and Cst complexes originate from each of seven total CRISPR loci and contain identical 5’ ends (8-nt CRISPR RNA repeat-derived 5’ tag sequences) but heterogeneous 3’ ends (containing variable amounts of downstream repeat sequences). These crRNA forms are distinct from Cmr-associated crRNAs, indicating different 3’ end processing pathways following primary cleavage of common pre-crRNAs. We predict that the newly identified Pfu Type I-A (Csa) and Type I-G (Cst)-containing crRNPs, like other previously characterized Type I CRISPR-Cas effector complexes, each function by carrying out crRNA-guided DNA targeting of invading mobile genetic elements. Taken together, our in-depth characterization of the three isolated native complexes provides clear evidence for three compositionally distinct crRNPs containing either Cmr, Csa, or Cst Cas proteins that together make up an impressive arsenal of CRISPR-Cas defense for a single organism. 4 Samples: Protein-associated small RNAs

Project description:The success of Enterococcus faecium and E. faecalis evolving as multi-resistant nosocomial pathogens is associated with their ability to acquire and share adaptive traits, including mobile genetic elements (MGE) encoding antimicrobial resistance. Here, we define the mobilome in representative successful hospital associated genetic lineages, E. faecium ST17 (n=10) and ST78 (n=10), E. faecalis ST6 (n=10) and ST40 (n=10) using DNA microarray analyses. The hybridization patterns of 272 targets representing plasmid backbones (n=85), transposable elements (n=85), resistance determinants (n=67), prophages (n=29), and CRISPR-cas sequences (n=6) separated the strains according to species, and for E. faecalis also according to STs. Although plasmids belonging to the RCR-, Rep_3-, RepA_N- and Inc18-families were well represented with no significant differences in prevalence, the presence of specific replicon classes differed highly between the species; E. faecium was dominated by rep17/pRUM, rep2/pRE25, rep14/EFNP1 and rep20/pLG1 and E. faecalis by rep9/pCF10, rep2/pRE25 and rep7. Tn916-elements conferring tetracycline resistance (tetM) were found in all E. faecalis strains, but only in two E. faecium strains. A significant higher prevalence of IS256-, IS3-, ISL3-, IS200/IS605-, IS110-, IS982-, and IS4-transposases were detected in E. faecium, and of IS110-, IS982- and IS1182-transposases in E. faecalis ST6 compared to ST40. Notably, the transposases of IS981, ISEfm1 and IS1678 which have only been reported in few enterococcal isolates, were well represented in the E. faecium strains. E. faecalis ST40 strains harboured possible functional CRISPR-Cas systems, and still resistance and prophage sequences were generally well represented. Gene targets defined as the enterococcal mobilome, including plasmids, IS elements and transposons, resistance determinants, prophage sequences and CRISPR-Cas systems were highly prevalent, underlining their potential importance in the evolution of hospital associated STs. An association between axe-txe to the RepA_N-family and ω-ε-ζ to the Inc18-family, implicates the contribution of TA-systems in stable plasmid maintenance carrying virulence and resistance determinants in enterococci. The concurrent presence of defined MGE and their associated resistance markers was generally confirmed and illustrates the importance of horizontal gene transfer in the development of multidrug resistant enterococci.

			Action	DRS
	SRR25781401.fastq.gz	Fastqsanger.gz
	SRR25781402.fastq.gz	Fastqsanger.gz
	SRR25781403.fastq.gz	Fastqsanger.gz
	SRR25781404.fastq.gz	Fastqsanger.gz
	SRR25781405.fastq.gz	Fastqsanger.gz

Dataset Information

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets