Ontology highlight
ABSTRACT:
PROVIDER: PRJNA574002 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR10177100.fastq.gz | Fastqsanger.gz | |||
| SRR10177101.fastq.gz | Fastqsanger.gz | |||
| SRR10177102.fastq.gz | Fastqsanger.gz | |||
| SRR10177103.fastq.gz | Fastqsanger.gz | |||
| SRR10177060.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 44 |
Similar Datasets
Project description:Tumor heterogeneity is a major challenge to the treatment of colorectal cancer (CRC). Recently, a transcriptome-based classification was developed, segregating CRC into four consensus molecular subtypes (CMS) with distinct biological and clinical characteristics. Here, we applied the CMS classification on CRC cell lines to identify novel subtype-specific drug vulnerabilities. We combined publicly available transcriptome data from multiple resources to assign 159 CRC cell lines to CMS. By integrating results from large scale drug screens, we discovered that CMS1 cancer is highly vulnerable to the survivin suppressor YM155. We confirmed our results using an independent panel of CRC cell lines and demonstrate a 100-fold higher sensitivity of CMS1 lines. This vulnerability was specific to YM155 and not observed for commonly used chemotherapeutic agents. In CMS1 cancer, low concentrations of YM155 induced apoptosis and expression signatures associated with NFkappaB and ER stress mediated apoptosis signaling. Using a genome-wide CRISPR/Cas9 screen, we discovered a novel role of genes involved in LDL-receptor recycling as modulators of YM155 response in CMS1 CRC. Our work shows that combining drug response data with CMS classification in cell lines can reveal specific vulnerabilities and propose YM155 as novel CMS1 specific drug.
2018-07-03 | GSE116529 | GEO
Project description:Tumor heterogeneity is a major challenge to the treatment of colorectal cancer (CRC). Recently, a transcriptome-based classification was developed, segregating CRC into four consensus molecular subtypes (CMS) with distinct biological and clinical characteristics. Here, we applied the CMS classification on CRC cell lines to identify novel subtype-specific drug vulnerabilities. We combined publicly available transcriptome data from multiple resources to assign 159 CRC cell lines to CMS. By integrating results from large scale drug screens, we discovered that CMS1 cancer is highly vulnerable to the survivin suppressor YM155. We confirmed our results using an independent panel of CRC cell lines and demonstrate a 100-fold higher sensitivity of CMS1 lines. This vulnerability was specific to YM155 and not observed for commonly used chemotherapeutic agents. In CMS1 cancer, low concentrations of YM155 induced apoptosis and expression signatures associated with NFkappaB and ER stress mediated apoptosis signaling. Using a genome-wide CRISPR/Cas9 screen, we discovered a novel role of genes involved in LDL-receptor recycling as modulators of YM155 response in CMS1 CRC. Our work shows that combining drug response data with CMS classification in cell lines can reveal specific vulnerabilities and propose YM155 as novel CMS1 specific drug. We performed expression profiling experiments in order to validate molecular subtypes for selected cell lines
2018-07-03 | GSE116528 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:This is data for the evaluation of a new way of counting sgRNAs in CRISPR screens using padlock probes and UMIs. It is compared to the typical PCR-based approach. In particular, a dropout screen was performed in MiaPaCa-2 cells using the Human Kinome CRISPR pooled library (Addgene #75314)
2024-08-18 | E-MTAB-14379 | biostudies-arrayexpress
Project description:Manuscript Title:
Co-targeting of BTK and MALT1 overcomes resistance to BTK inhibitors in mantle cell lymphoma
Journal:
Journal of Clinical Investigation
Authors
Vivian Changying Jiang1, Yang Liu1, Junwei Lian1, Shengjian Huang1, Alexa Jordan1, Qingsong Cai1, Fangfang Yan3, Joseph Mitchell McIntosh1, Yijing Li1, Yuxuan Che1, Zhihong Chen1, Jovanny Vargas1, Maria Badillo1, JohnNelson Bigcal1, Heng-Huan Lee1, Wei Wang1, Yixin Yao1, Lei Nie1, Christopher Flowers1, and Michael Wang1, 2*
Abstract
Bruton’s tyrosine kinase (BTK) is a proven target in mantle cell lymphoma (MCL), an aggressive subtype of non-Hodgkin lymphoma. However, resistance to BTK inhibitors is a major clinical challenge. We here report that MALT1 is one of the top overexpressed genes in ibrutinib-resistant MCL cells, while expression of CARD11, which is upstream of MALT1, is decreased. MALT1 genetic knockout or inhibition produced dramatic defects in MCL cell growth regardless of ibrutinib sensitivity. Conversely, CARD11 knockout cells showed anti-tumor effects only in ibrutinib-sensitive cells, suggesting that MALT1 overexpression could drive ibrutinib resistance via bypassing BTK-CARD11 signaling. Additionally, BTK knockdown and MALT1 knockout markedly impaired MCL tumor migration and dissemination, and MALT1 pharmacological inhibition decreased MCL cell viability, adhesion, and migration by suppressing NF-κB, PI3K-ATK-mTOR, and integrin signaling. Importantly, co-targeting MALT1 with safimaltib and BTK with pirtobrutinib induced potent anti-MCL activity in ibrutinib-resistant MCL cell lines and patient-derived xenografts. Therefore, we conclude that MALT1 overexpression associates with resistance to BTK inhibitors in MCL, targeting abnormal MALT1 activity could be a promising therapeutic strategy to overcome BTK inhibitor resistance, and co-targeting of MALT1 and BTK should improve MCL treatment efficacy and durability as well as patient outcomes.
Dataset description:
The bulk RNA-seq dataset was generated for the cell lines below and used for two major purposes:
1. DEG analysis and GSEA analysis comparing IBN-R and IBN-S cells
2. DEG analysis and GSEA analysis comparing MCL cells with/without MI-2 treatment.
sample Cell MI-2 Ibrutinib (IBN) Venetoclax (VEN) Used for IBN-R vs IBN-S comparison Used for MI-2 vs untreated (DMSO)
H9 Granta519 - R S yes
H21 Granta519 - R S yes
H33 Granta519 - R S yes
H10 Granta519-VEN-R - R R yes
H22 Granta519-VEN-R - R R yes
H34 Granta519-VEN-R - R R yes
H3 JeKo BTK KD_1 - R R yes yes
H15 JeKo BTK KD_1 - R R yes yes
H27 JeKo BTK KD_1 - R R yes yes
H5 JeKo BTK KD_2 - R R yes yes
H17 JeKo BTK KD_2 - R R yes yes
H29 JeKo BTK KD_2 - R R yes yes
H1 JeKo-1 - S R yes yes
H13 JeKo-1 - S R yes yes
H25 JeKo-1 - S R yes yes
H7 Mino - S S yes
H19 Mino - S S yes
H31 Mino - S S yes
H8 Mino-VEN-R - S R yes
H20 Mino-VEN-R - S R yes
H32 Mino-VEN-R - S R yes
H11 Rec-1 - S S yes
H23 Rec-1 - S S yes
H12 Rec-VEN-R - S S yes
H24 Rec-VEN-R - S R yes
H36 Rec-VEN-R - S R yes
H35 Rec-1 -- S R yes
H4 JeKo BTK KD_1 + MI-2 + yes
H16 JeKo BTK KD_1 + MI-2 + yes
H28 JeKo BTK KD_1 + MI-2 + yes
H6 JeKo BTK KD_2 + MI-2 + yes
H18 JeKo BTK KD_2 + MI-2 + yes
H30 JeKo BTK KD_2 + MI-2 + yes
H2 JeKo-1 + MI-2 + yes
H14 JeKo-1 + MI-2 + yes
H26 JeKo-1 + MI-2 + yes
| EGAD00001009771 | EGA
Project description:Targeted genome editing holds great promise in biology. However, efficient genome modification, including gene knock-in, remains an unattained goal in multiple cell types and loci due to poor transfection efficiencies and low target genes expression, impeding the positive selection of recombined cells. Here, we describe a genome editing approach to achieve efficient gene targeting using hard to transfect erythroid cell lines. We demonstrate robust fluorescent protein knock-in efficiency in low expressed transcription factor gene loci (e.g. Myb or Zeb1). We further show the ability to target several genes in individual cells, exemplified by MYB-GFP and NuMA-Cherry double knock-in, allowing multicolor labeling of regulatory factors at physiological endogenous levels. Our knock-in tagging approach allowed us to perform genome-wide TF analysis at increased signal-to-noise ratios, and highlighted previously unidentified MYB target genes and pathways. Overall, we establish a versatile CRISPR-Cas9-based platform, offering attractive opportunities for the dissection of the erythroid differentiation process.
2023-07-24 | GSE228372 | GEO
Project description:To investigate the molecular mechanisms by which YM155, a survivin inhibitor, suppresses tumor progression, HT29 human colon cancer cells were treated with YM155 for 24 hours. The aim was to elucidate how YM155 affects the expression of various cancer-related genes, including survivin.
2026-06-22 | GSE298631 | GEO
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:eHap CRISPR-Cas9 mutagenized cells with no selection serves as a control. RPS6p antibody staining on the mutagenized eHap cells was used in a flow-sorting approach to isolate RPS6p high and low populations respectively. The genomic DNA from these different samples was isolated, subjected to PCR to amplify the genomically-encoded guide RNA sequences, the product(s) of which was then sequenced on a Hi-Seq X Ten instrument by Novogene.
2020-04-23 | E-MTAB-8926 | biostudies-arrayexpress