Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
Project description:Here we report 16s rRNA data in gut microbiota of hepatocellular carcinoma (HCC) patients with HBV induced HCC (HBVC) and non-HBV induced HCC (NHBVC) compared with healthy volunteers. A total of 2047 operational taxonomic units (OTUs) were identified in the sequence data. Our data shows that the NHBVC patients harbor lower anti-inflammatory bacteria and more pro-inflammatory bacteria, while the HBVC patients harbor more anti-inflammatory bacteria.
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.
Project description:Hypervariable regions V3-V5 of bacterial 16S rRNA genes. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/
Project description:Purpose: This study aims to compare and analyze the differences in bacterial community composition in fecal samples from mice treated with Control(DW), Vancomycin (VAN), Ampicillin (AMP), Neomycin (NEO), Metronidazole (MET), and a combination of all antibiotics (ALL, VANM) using 16S rRNA sequencing. Methods: Each antibiotics treated mice's fecal samples were collected and stored -80'c until analyzation. DNA was extracted using the NucleoSpin DNA Stool Kit (MACHEREY-NAGEL) following the manufacturer’s protocol. Metagenomic sequencing was performed on an Illumina MiSeq platform (Illumina), targeting the V3 and V4 regions of the 16S rRNA gene according to the manufacturer's instructions. PCR products were purified using AMPure XP beads, and sequencing adapters were added using the Nextera XT Index Kit (Illumina). The library was further purified with AMPure XP beads and quantified using automated electrophoresis with the TapeStation System (Agilent). Sequencing was performed using the MiSeq v3 reagent kit (Illumina), following the manufacturer’s protocol. Results: QIIME2 (v2023.02) was used to process and analyze 16S rRNA gene amplicon sequencing data, from sequence preprocessing to taxonomic classification. Paired-end sequences were merged and quality-filtered using Deblur. The resulting amplicon sequence variants (ASVs) were used for downstream analyses. Conclusions: Our study presents a comparative analysis of bacterial community composition in fecal samples from antibiotic-treated mice. We observed that microbiota composition varied distinctly depending on the type of antibiotic administered.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.