Project description:16S rRNA V3-V4 amplicon sequencing was performed on fecal samples from 12 male C57BL/6J mice across three groups (4 replicates each): Control (distilled water, 3 days), Model (distilled water, 3 days + APAP 300 mg/kg i.p.), and PoH (PO extract 3 g/kg p.o. daily for 3 days + APAP 300 mg/kg i.p.). Sequencing was performed on an Illumina NovaSeq 6000 platform using paired-end 250bp reads.
Project description:v3-v4 16S rRNA sequencing was used to characterize the differences in microbiota between specimens of breast cancer and healthy surrounding tissue in adult Algerian females
Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.