Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:Sequencing of 16S ribosomal RNA (rRNA) gene, which has improved the characterization of microbial community, has made it possible to detect a low level Helicobacter pylori (HP) sequences even in HP-negative subjects which were determined by a combination of conventional methods. This study was conducted to obtain a cutoff value for HP colonization in gastric mucosa biopsies and gastric juices by the pyrosequencing method. Corresponding author: Department of Internal Medicine, Seoul National University Bundang Hospital, Seoungnam, Gyeonggi-do, Korea; Department of Internal Medicine and Liver Research Institute, Seoul National University College of Medicine, Seoul, Korea (Tel., +82-31-787-7008; e-mail, nayoungkim49@empas.com). Microbial DNA from gastric mucosal samples [gastric antrum (n=63, mucosal biopsy), follow-up sample on gastric antrum (n=16, mucosal biopsy), and gastric body (n=18, mucosal biopsy)] and gastric juices (n=4, not mucosal biopsy) was amplified by nested PCR using universal bacterial primers, and the 16S rRNA genes were pyrosequenced.
Project description:In this study, we performed a comparative analysis of gut microbiota composition and gut microbiome-derived bacterial extracellular vesicles (bEVs) isolated from patients with solid tumours and healthy controls. After isolating bEVs from the faeces of solid tumour patients and healthy controls, we performed spectrometry analysis of their proteomes and next-generation sequencing (NGS) of the 16S gene. We also investigated the gut microbiomes of faeces from patientsand controls using 16S rRNA sequencing. Machine learning was used to classify the samples into patients and controls based on their bEVs and faecal microbiomes.
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
Project description:Hypervariable regions V3-V5 of bacterial 16S rRNA genes. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction A ten chip study using PCR amplicons from cloned 16S rRNA genes and from diverse soil 16S rRNAs, with PCR primers specific to the Division Acidobacteria. Each chip measures the signal from 42,194 probes (in triplicate) targeting Acidobacteria division, subdivision, and subclades as well as other bacterial phyla. All samples except one (GSM464591) include 2.5 M betaine in the hybridization buffer. Pair files lost due to a computer crash.