Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S amplicon sequenced samples from Nash's Field Survey 2013

PROVIDER: PRJNA1152936 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR30414600.fastq.gz	Fastqsanger.gz
	SRR30414601.fastq.gz	Fastqsanger.gz
	SRR30414602.fastq.gz	Fastqsanger.gz
	SRR30414603.fastq.gz	Fastqsanger.gz
	SRR30414604.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 66

Similar Datasets

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Project description:16S Amplicon sequencing of tobacco field soil samples

| PRJNA814864 | ENA

The mediating roles of the oral microbiome in saliva and subgingival sites between e-cigarette smoking and gingival inflammation

Project description:In this paper, we first report that EC smoking significantly increases the odds of gingival inflammation. Then, we seek to identify and explain the mechanism that underlies the relationship between EC smoking and gingival inflammation via the oral microbiome. We performed mediation analyses to assess if EC smoking affects the oral microbiome, which in turn affects gingival inflammation. For this, we collected saliva and subgingival samples from EC users and non-users and profiled their microbial compositions via 16S rRNA amplicon sequencing. We then performed α-diversity, β-diversity, and taxonomic differential analyses to survey the disparity in microbial composition between EC users and non-users. We found significant increases in α-diversity in EC users and disparities in β-diversity between EC users and non-users.

2022-12-09 | GSE201949 | GEO

human skin metagenome

Project description:16s amplicon sequencing of foot skin microbiome samples. Random survey

| PRJNA263008 | ENA

Project description:Targeted Bacterial 16S rRNA amplicon survey from zebra finch cloacal samples

| PRJNA481469 | ENA

Project description:Lost City Hydrothermal Field 2018 chimney biofilm grab samples (16S rRNA amplicon)

| PRJNA1072998 | ENA

Microbial communities in the gut of the beetle Odontotaenius disjunctus

Project description:16S amplicon pool analyses of the four gut sections of the wood-feeding beetle, Odontotaenius disjunctus The beetle is purely wood feeding, and we aim to first characterize the community that exist within the gut sections

2012-08-14 | GSE40067 | GEO

Amplicon sequencing of a K562 cell line model with a patient-based t(3;8) translocation following CRISPR treatment

Project description:Genome editing was conducted on a t(3;8) K562 model to investigate the effects of deleting different modules or CTCF binding sites within the MYC super-enhancer. To check mutations after targeting with CRISPR-Cas9 we performed amplicon sequencing using the Illumina PCR-based custom amplicon sequencing method using the TruSeq Custom Amplicon index kit (Illumina). The first PCR was performed using Q5 polymerase (NEB), the second nested PCR with KAPA HiFi HotStart Ready mix (Roche). Samples were sequenced paired-end (2x 250bp) on a MiSeq (Illumina).

2021-07-26 | E-MTAB-9937 | biostudies-arrayexpress

hydrothermal vent metagenome

Project description:Amplicon sequencing of 16S rRNA genes from hydrothermal vent samples (Logatchev field, MAR)

| PRJNA177595 | ENA