Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).
Project description:Secondary bacterial pneumonia following influenza infection is a significant cause of mortality worldwide. Upper respiratory tract pneumococcal carriage is important as both determinants of disease and population transmission. The immunological mechanisms that contain pneumococcal carriage are well-studied in mice but remain unclear in humans. Loss of this control of carriage following influenza infection is associated with secondary bacterial pneumonia during seasonal and pandemic outbreaks. We used a human type 6B pneumococcal challenge model to show that carriage acquisition induces early degranulation of resident neutrophils and recruitment of monocytes to the nose. Monocyte function associated with clearance of pneumococcal carriage. Prior nasal infection with live attenuated influenza virus induced inflammation, impaired innate function and altered genome-wide nasal gene responses to pneumococcal carriage. Levels of the cytokine IP-10 promoted by viral infection at the time of pneumococcal encounter was positively associated with bacterial density. These findings provide novel insights in nasal immunity to pneumococcus and viral-bacterial interactions during co-infection.
Project description:Between January 2021 and September 2021, a total of 5 pairs of adjacent normal tissues and CRC tumor tissues were collected at Suzhou Municipal Hospital. Written informed consent was secured from all participating patients prior to the commencement of the study. The study protocol, including all experiments, was reviewed and approved by the Ethics Committee of Suzhou Municipal Hospital.
Project description:Background. Pneumococcus is a major human pathogen and the polysaccharide capsule is considered its main virulence factor. Nevertheless, strains lacking a capsule, named non-typeable pneumococcus (NT), are maintained in nature and frequently colonise the human nasopharynx. Interest in these strains, not targeted by any of the currently available pneumococcal vaccines, has been rising as they seem to play an important role in the evolution of the species. Currently, there is a paucity of data regarding this group of pneumococci. Also, questions have been raised on whether they are true pneumococci. We aimed to obtain insights in the genetic content of NT and the mechanisms leading to non-typeability and to genetic diversity. Methods. A collection of 52 NT isolates representative of the lineages circulating in Portugal between 1997 and 2007, as determined by pulsed-field gel electrophoresis and multilocus sequence typing, was analysed. The capsular region was sequenced and comparative genomic hybridisation (CGH) using a microarray covering the genome of 10 pneumococcal strains was carried out. The presence of mobile elements was investigated as source of intraclonal variation. Results. NT circulating in Portugal were found to have similar capsular regions, of cps type NCC2, i.e., having aliB-like ORF1 and aliB-like ORF2 genes. The core genome of NT was essentially similar to that of encapsulated strains. Also, competence genes and most virulence genes were present. The few virulence genes absent in all NT were the capsular genes, type-I and type-II pili, choline-binding protein A (cbpA/pspC), and pneumococcal surface protein A (pspA). Intraclonal variation could not be entirely explained by the presence of prophages and other mobile elements. Conclusions. NT circulating in Portugal are a homogeneous group belonging to cps type NCC2. Our observations support the theory that they are bona-fide pneumococcal isolates that do not express the capsule but are otherwise essentially similar to encapsulated pneumococci. Thus we propose that NT should be routinely identified and reported in surveillance studies.