Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

DNA bendability regulates transcription factor binding to nucleosomes [PIONEAR-seq and SELEX-seq]

ABSTRACT: DNA bendability regulates transcription factor binding to nucleosomes [PIONEAR-seq and SELEX-seq]

PROVIDER: PRJNA1244796 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR32941900_1.fastq.gz	Fastqsanger.gz
	SRR32941900_2.fastq.gz	Fastqsanger.gz
	SRR32942000_1.fastq.gz	Fastqsanger.gz
	SRR32942000_2.fastq.gz	Fastqsanger.gz
	SRR32941901_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 536

Similar Datasets

DNA bendability regulates transcription factor binding to nucleosomes [PIONEAR-seq and SELEX-seq]

Project description:Cell fates are controlled by ‘pioneers’, sequence-specific transcription factors (TFs) that bind recognition motifs on nucleosomes (‘pioneer binding’). Pioneers occupy a minority of their recognition sequences in the genome, suggesting that the sequence context regulates their binding. Here, we developed PIONEAR-seq, a high-throughput biochemical assay to characterize pioneer binding to nucleosomes. We used PIONEAR-seq to assay 11 human TFs for binding to nucleosomes based on Widom 601 versus genomic sequences. We found that pioneer binding, while mediated primarily by TFs' recognition motifs, senses the broader nucleosome sequence context and that TFs previously found to be dyad or periodic binders on nucleosomes assembled on synthetic sequences exhibit exclusively end binding to nucleosomes based on genomic sequences. We propose a model where the nucleosome exploits the local bendability of the DNA sequence to position pioneer binding, revealing another cis-regulatory layer in eukaryotes.

2025-05-01 | GSE293487 | GEO

DNA bendability regulates transcription factor binding to nucleosomes [MNase-seq]

2025-05-01 | GSE293024 | GEO

DNA bendability regulates transcription factor binding to nucleosomes [MNase-seq]

Project description:DNA bendability regulates transcription factor binding to nucleosomes [MNase-seq]

| PRJNA1242366 | ENA

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-M-NM-:B as an example

Project description:We provided an improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor. We valided the strategy by characterzing the DNA-binding specificty of NF-M-NM-:B p50 dimer. Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress

DNA bendability regulates transcription factor binding to nucleosomes

Project description:DNA bendability regulates transcription factor binding to nucleosomes

| PRJNA1244853 | ENA

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-κB as an example

2014-05-05 | GSE48660 | GEO

SELEX-seq of AP1 homodimer

Project description:These datasets represent the results of a SELEX-seq experiment to identify the DNA binding specificity of Arabidopsis thaliana AP1-AP1 dimers

2025-10-22 | GSE230171 | GEO

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

HT-SELEX of wild-type and mutated versions of recombinant DNA binding domain of SALL4

Project description:To investigate the differences in DNA binding specificity of wild-type SALL4 C2H2 zinc finger cluster 4 (ZFC4) and disease causing mutations in SALL4 ZFC4, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified wild-type SALL4 ZFC4 domain, mutated SALL4 ZFC4 (R900W) and mutated SALL4 ZFC4 (G921D) combined with no protein control experiment.

2023-01-04 | E-MTAB-11519 | biostudies-arrayexpress

DNA Binding Specificities of Fkh1, Fkh2, Hcm1, and Fhl1 Revealed by SELEX-seq

Project description:Quantifying the preferences of DNA binding proteins is an essential step in determining how transcription factors (TFs) interact with their targets in the genome. High-throughput in vitro binding assays have been used to identify the inherent DNA preferences of TFs in a controlled environment isolated from confounding factors such as genome accessibility, DNA methylation, and TF binding cooperativity. Unfortunately, the limited variable region or sequencing depth typically utilized by many of the available experimental approaches makes it difficult to measure the preferences of moderate- to low-affinity binding sites, and impossible to measure small-scale differences between closely related homologs. The Forkhead box (FOX) family of TFs is known to play a crucial role in regulating a variety of key processes from proliferation and development, to tumor suppression and aging. By using the high-sequencing depth SELEX-seq approach to study all four FOX homologs in Saccharomyces cerevisiae, we have been able to precisely quantify the contribution and importance of nucleotide positions flanking the core of the binding sites. Essential to this process was the alignment of our SELEX-seq reads to a set of candidate core sequences determined by two newly developed strategies of alignment and reprioritization applied to enriched k-mers.

2023-04-26 | GSE178811 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data