Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1274432 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR33912155_1.fastq.gz | Fastqsanger.gz | |||
| SRR33912155_2.fastq.gz | Fastqsanger.gz | |||
| SRR33912156_1.fastq.gz | Fastqsanger.gz | |||
| SRR33912156_2.fastq.gz | Fastqsanger.gz | |||
| SRR33912157_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 32 |
Similar Datasets
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114858 | GEO
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114857 | GEO
Project description:CRISPR RNA-guided detection and degradation of foreign DNA is a dynamic process. Viruses can interfere with this cellular defense by expressing small proteins called anti-CRISPRs. While structural models of anti-CRISPRs bound to their target complex provide static snapshots that inform mechanism, the dynamics and thermodynamics of these interactions are often overlooked. Here we use hydrogen deuterium exchange-mass spectrometry (HDX-MS) and differential scanning fluorimetry (DSF) experiments to determine how anti-CRISPR binding impacts the conformational landscape of the type IF CRISPR RNA guided surveillance complex (Csy) upon binding of two different anti-CRISPR proteins (AcrIF9 and AcrIF2). The results demonstrate that AcrIF2 binding relies on enthalpic stabilization, whereas AcrIF9 uses an entropy driven reaction to bind the CRISPR RNA-guided surveillance complex. Collectively, this work reveals the thermodynamic basis and mechanistic versatility of anti-CRISPR-mediated immune suppression. More broadly, this work presents a striking example of how allosteric effectors are employed to regulate nucleoprotein complexes.
2022-11-01 | PXD036446 | Pride
Project description:Transposon-encoded tnpB and iscB genes encode RNA-guided DNA nucleases that promote their own selfish spread through targeted DNA cleavage and homologous recombination. These widespread gene families were repeatedly domesticated over evolutionary timescales, leading to the emergence of diverse CRISPR-associated nucleases including Cas9 and Cas12. We set out to test the hypothesis that TnpB nucleases may have also been repurposed for novel, unexpected functions other than CRISPR-Cas. Here, using phylogenetics, structural predictions, comparative genomics, and functional assays, we uncover multiple instances of programmable transcription factors that we name TnpB-like nuclease-dead repressors (TldR). These proteins employ naturally occurring guide RNAs to specifically target conserved promoter regions of the genome, leading to potent gene repression in a mechanism akin to CRISPRi technologies invented by humans. Focusing on a TldR clade found broadly in Enterobacteriaceae, we discover that bacteriophages exploit the combined action of TldR and an adjacently encoded phage gene to alter the expression and composition of the host flagellar assembly, a transformation with the potential to impact motility, phage susceptibility, and host immunity. Collectively, this work showcases the diverse molecular innovations that were enabled through repeated exaptation of transposon-encoded genes, and reveals the evolutionary trajectory of diverse RNA-guided transcription factors.
2024-04-22 | GSE245749 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:We develop a CRISPR-Assisted RNA-Protein Interaction Detection method (CARPID), which leverages CRISPR/CasRx-based RNA targeting and proximity labeling to identify binding proteins of specific lncRNA in the native cellular context.
2020-05-20 | PXD015702 |
Project description:RNA-guided endonucleases form the crux of diverse biological processes and technologies, including adaptive immunity, transposition, and genome editing. Some of these enzymes are components of insertion sequences (IS) in the IS200/IS605 and IS607 transposon families. Both IS families encode a TnpA transposase and TnpB nuclease, an RNA-guided enzyme ancestral to CRISPR-Cas12. In eukaryotes and their viruses, TnpB homologs occur as two distinct types, Fanzor1 and Fanzor2. We analyzed the evolutionary relationships between prokaryotic TnpBs and eukaryotic Fanzors, revealing that a clade of IS607 TnpBs with unusual active site arrangement found primarily in cyanobacteria likely gave rise to both types of Fanzors. The widespread nature of Fanzors imply that the properties of this particular group of IS607 TnpBs were particularly suited to adaptation and evolution in eukaryotes and their viruses. Biochemical analysis of a prokaryotic IS607 TnpB and virally encoded Fanzor1s revealed features that may have fostered co-evolution between TnpBs/Fanzors and their cognate transposases. These results provide insight into the evolutionary origins of a ubiquitous family of RNA-guided proteins that shows remarkable conservation across the three domains of life.
2023-11-18 | GSE246134 | GEO
Project description:Insertion sequences (IS) are compact and pervasive transposable elements found in bacteria, which encode only the genes necessary for their mobilization and maintenance. IS200/IS605 elements undergo ‘peel-and-paste’ transposition catalyzed by a TnpA transposase, but intriguingly, they also encode diverse, TnpB-family genes that are evolutionarily related to the CRISPR-associated effectors Cas9 and Cas12. Recent studies demonstrated that TnpB-family enzymes function as RNA-guided DNA endonucleases, but the broader biological role of this activity has remained enigmatic. Here we show that IscB and TnpB are essential to prevent loss of the donor IS element and potential transposon extinction as a consequence of the TnpA transposition mechanism. We first performed phylogenetic analysis of IscB/TnpB proteins and selected a family of related IS elements from Geobacillus stearothermophilus that we predicted would be mobilized by a common TnpA homolog. After reconstituting transposition using a heterologous expression system in E. coli, we found that IS elements were readily lost from the donor site due to the activity of TnpA in rejoining the flanking sequences back together upon excision. However, these IS elements also encode non-coding RNAs that guide TnpB and IscB nucleases to precisely recognize and cleave these excision products, leading either to elimination of the excision product or re-installation of the transposon through recombination. Indeed, under experimental conditions in which TnpA and TnpB-RNA complexes were co-expressed together with a genomically integrated IS element, transposon retention was significantly increased relative to conditions expressing TnpA alone. Remarkably, both TnpA and TnpB recognize the same AT-rich transposon-adjacent motif (TAM) during transposon excision and RNA-guided DNA cleavage, respectively, revealing a striking convergence in the evolution of DNA sequence specificity between transposase and nuclease. Collectively, our study reveals that RNA-guided DNA cleavage is a primal biochemical activity that arose to bias the selfish inheritance of transposable elements, which was later co-opted during the evolution of CRISPR-Cas adaptive immunity for antiviral defense.
2023-06-01 | GSE223127 | GEO
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:TnpB nucleases represent the evolutionary precursors to CRISPR-Cas12 and are widespread in all domains of life. IS605-family TnpB homologs function in bacteria as programmable RNA-guided homing endonucleases driving transposon maintenance through DSB-stimulated homologous recombination. Here we uncover molecular mechanisms of transposition lifecycle of IS607-family elements that, remarkably, also encode group I introns. We discover molecular features for a candidate ‘IStron’ from Clostridium botulinum that allow the element to carefully control the relative levels of spliced products versus functional guide RNAs. Our results suggest that IStron transcripts have evolved a sensitive equilibrium to balance competing and mutually exclusive activities that promote transposon maintenance while limiting adverse fitness costs on the host. Collectively, this work highlights molecular innovation in the multi-functional utility of transposon-encoded noncoding RNAs.
2024-05-06 | GSE261343 | GEO