Project description:To explain the mechanism that miR-29c affects the cell proliferation, we attempted to identify the miR-29c target genes in gastric carcinoma. The expression profiles in MKN45, MKN7 and MKN74 cells transfected with miR-29c oligo or Negative control oligo were obtained from microarray analysis. Then, the genes differentially expressed (Fold change >= 2.0) in miR-29c-transfected cells compared with negative control-transfected ones were identified in each cell lines, respectively. The differentially expressed genes shared among 3 cell lines were identified as the candidates for miR-29c targets. Human gastric cancer cell lines, MKN45, MKN74 and MKN7 were transfected with miR-29c oligo or negative control oligo (n=2) (Ambion). At 24h after, total RNA was extracted and microarray analysis was performed. The genes with common expression changes among three cell lines miR-29c-transfected were identified as the candidates for miR-29c targets.
Project description:MiR-29c-3p functions as a critical tumor suppressor in gastric cancer (GC) pathogenesis. Restoration of MiR-29c-3p expression significantly suppresses cellular proliferation, migration, and invasion, while inducing apoptosis and G1 phase arrest in GC cells. Transcriptomic profiling reveals that MiR-29c-3p modulates genes involved in signal transduction, angiogenesis, and extracellular matrix reorganization, primarily through inhibition of the PI3K/AKT signaling cascade. Mechanistically, MiR-29c-3p directly targets the SLC6A14 oncogene, as validated by RNA pull-down and dual-luciferase assays. This targeting is essential for MiR-29c-3p’s tumor-suppressive function: suppression of SLC6A14 blocks epithelial-mesenchymal transition (EMT) and inactivates PI3K/pAKT signaling in GC cells. Both in vitro and in vivo models confirm that MiR-29c-3p upregulation inhibits tumor progression via the SLC6A14-PI3K/AKT axis. Our findings establish a molecular framework wherein MiR-29c-3p antagonizes GC progression by directly repressing SLC6A14 and its downstream PI3K/AKT pathway, positioning MiR-29c-3p as a potential therapeutic target in GC management.
Project description:To explain the mechanism that miR-29c affects the cell proliferation, we attempted to identify the miR-29c target genes in gastric carcinoma. The expression profiles in MKN45, MKN7 and MKN74 cells transfected with miR-29c oligo or Negative control oligo were obtained from microarray analysis. Then, the genes differentially expressed (Fold change >= 2.0) in miR-29c-transfected cells compared with negative control-transfected ones were identified in each cell lines, respectively. The differentially expressed genes shared among 3 cell lines were identified as the candidates for miR-29c targets.
Project description:<p>BRCA1 mutations are a hallmark of hereditary ovarian cancer, strongly linked to deficiencies in homologous recombination (HR) DNA repair and impaired DNA replication fork protection. However, its roles in cancer progression beyond maintaining genomic integrity remain poorly understood. Through metabolomics approaches, we found BRCA1-deficiency strikingly increased choline metabolism. Loss of BRCA1 promotes choline uptake through upregulating choline transporter-like protein 4 (CTL4). BRCA1 directly binds and recruits EZH2-mediated H3K27Me3 deposition to CTL4 promoter. CTL4 was therefore overexpressed in ovarian cancer tissues with BRCA1 mutations. Furthermore, BRCA1-deficiency significantly promotes ovarian cancer invasion, while inhibition of CTL4 reverses the high metastatic potential of BRCA1-deficient ovarian cancer cells, suggesting the functionality and specificity of CTL4 as a therapeutic target. Additionally, we discovered that phosphocholine, the choline metabolite increased by CTL4 overexpression, interacted with and stabilized the epithelial-to-mesenchymal transition inducer FAM3C in BRCA1-deficient ovarian cancer cells. Importantly, we identified a potent CTL4 inhibitor, DT-13, which significantly reduces choline metabolism and effectively suppresses metastasis in BRCA1-deficient ovarian cancers. Therefore, our study uncovers a mechanism underlying metastasis in BRCA1-deficient cancers and identifies CTL4 as a therapeutic target for metastatic ovarian cancer patients with BRCA1 mutations.</p>
Project description:Gene expression profiling of immortalized human mesenchymal stem cells with hTERT/E6/E7 transfected MSCs. hTERT may change gene expression in MSCs. Goal was to determine the gene expressions of immortalized MSCs.
Project description:While the basal-like subtype accounts for only a small subset of all breast cancer cases, it is associated with the worst prognosis. The majority of basal-like tumors are triple-negative (ER-, PR-, and HER2-negative), and thus lack molecular targets for therapy. To identify potential molecular markers and/or pathways that are critical to the basal-like tumor phenotype, we investigated the deregulation of microRNAs in primary breast tumors from an ethnically diverse cohort of patients. Forty-four microRNAs were identified as down-regulated in basal-like tumors compared to luminal-A tumors. MicroRNA-29c (miR-29c) was the most significantly down-regulated microRNA. In breast cancer cells in vitro, miR-29c was capable of regulating phenotypes associated with basal-like tumors such as cell invasion and drug sensitivity. Exogenous expression of miR-29c sensitizes UACC 3199 to doxorubicin-induced killing, while its inhibition leads to resistance to doxorubicin-induced killing. In addition, miR-29c decreases invasiveness of UACC-3199 cells, along with down-regulation of extracellular matrix (ECM) genes (LAMC1 and COL5A2) and ECM modifying enzyme LOXL2. In addition, miR-29c directly regulates B-MYB, an oncogene over expressed in basal-like tumors and co-expression of miR-29c and B-MYB abolishes UACC 3199 sensitivity to doxorubicin. Furthermore, our work demonstrates a regulatory role for the transcription factor GATA3 in miR-29c expression in breast cancer. Our findings support a role for miR-29c in basal-like breast tumorigenesis that is linked to drug resistance.
Project description:Transcriptional profiling of human mesenchymal stem cells comparing normoxic MSCs cells with hypoxic MSCs cells. Hypoxia may inhibit senescence of MSCs during expansion. Goal was to determine the effects of hypoxia on global MSCs gene expression.
Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.
Project description:Gene methylation profiling of immortalized human mesenchymal stem cells comparing HPV E6/E7-transfected MSCs cells with human telomerase reverse transcriptase (hTERT)- and HPV E6/E7-transfected MSCs. hTERT may increase gene methylation in MSCs. Goal was to determine the effects of different transfected genes on global gene methylation in MSCs.