Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Homo sapiens

ABSTRACT: A public-private-academic consortium, Genome-in-a-Bottle (GIAB), hosted by NIST to develop reference materials and standards for clinical sequencing

PROVIDER: PRJNA200694 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other
		Other
	SRR11032700_1.fastq.gz	Fastqsanger.gz
	SRR11032701_1.fastq.gz	Fastqsanger.gz
	SRR11032702_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 3497

Similar Datasets

The SEQC2 epigenomics quality control (EpiQC) study [methylation array]

Project description:We present a multi-platform assessment and a global resource for epigenetics research from the FDA's Epigenomics Quality Control (EpiQC) Group. The study design leverages seven human cell lines that are designated as reference materials and publicly available from the National Institute of Standards and Technology (NIST) and Genome in a Bottle (GIAB) consortium. These samples were subject to a variety of genome-wide methylation interrogation approaches across six independent laboratories, with a primary focus on 5-methylcytosine modifications.

2023-04-21 | GSE230132 | GEO

The SEQC2 epigenomics quality control (EpiQC) study

2021-10-26 | GSE186383 | GEO

Synthetic data - Genome in a Bottle

Project description:In May, the National Institute of Standards and Technology (NIST) released its first genome in a bottle, a reference sample of DNA for validating human genome sequences. This so-called truth sequence comes from a decades-old sample donated by a Utah woman for (other) research purposes (NA12878 cell line), which, over the years, has been one of the most studied, and hence best-characterized, human samples. Seeing genomic medicine moving toward mainstream healthcare, researchers at NIST recognized the need for a reference human genome and assembled a private-public consortium in 2012 to create one. As detailed in a 2014 Nature Biotechnology paper (Nat. Biotechnol.32, 246Ã¢Â€Â“251, 2014), the group integrated and arbitrated among sequences from 14 data sets, five sequencing technologies, seven read mappers and three variant callers.

| EGAS00001005591 | EGA

Data for demonstrating new features in compareMS2 2.0

Project description:This submission contains datasets from several species used to demonstrate new features in compareMS2 2.0. Tandem mass spectrometry data from California sea lion, chimpanzee, dog, human, rock hyrax, and white-tailed deer sera were graciously provided with permission from an ongoing collaboration with Dr. Michael G. Janech (College of Charleston) as part of the CoMPARe Program (Comparative Mammalian Proteome Aggregator Resource). Specifically, the California sea lion sera were provided by The Marine Mammal Center (Sausalito, CA), the chimpanzee, rock hyrax, and white-tailed deer sera were provided by The Chattanooga Zoo, and the dog serum from Gus (Ohlandt Veterinary Clinic, Charleston, SC). In addition to institutional and NMFS permits and approval, data collection was performed under NIST ACUC MML-AR20-0001. The identification of certain commercial equipment, instruments, software, or materials does not imply recommendation or endorsement by the National Institute of Standards and Technology, nor does it imply that the products identified are necessarily the best available for the purpose.

2022-10-06 | PXD034932 | Pride

RNA-Seq on libraries made from serial dilutions of Drosophila melanogaster S2 cell mRNA and ERCC external RNA controls

Project description:RNA-Seq on libraries made from serial dilutions of mRNA from Drosophila melanogaster S2 cell and the External RNA Controls Consortium (ERCC) external RNA controls. We evaluated performance of RNA-Seq by serially diluting a complex pool of known synthetic PolyA+ mRNAs from the External RNA Controls Consortium (ERCC) and PolyA+ mRNA from Drosophila S2 cells. ERCC mRNAs were obtained under Phase V testing from the National Institutes of Standards and Technology (NIST). The ERCC pool contained 96 species of mRNA of various lengths and GC content covering a 2^20 concentration range. Libraries were constructed with 100ng to 10pg of input mRNA. Our data shows an outstanding linear fit between RNA-Seq read density and known input amounts.

2010-04-19 | GSE20555 | GEO

RNA-Seq on libraries made from ERCC external RNA controls, and a mixture of D. melanogaster S2 cell mRNA and ERCC mRNAs

Project description:RNA-Seq on libraries made from External RNA Controls Consortium (ERCC) external RNA controls, and a mixture of mRNA from Drosophila melanogaster S2 cell and ERCC mRNAs. We evaluated performance of RNA-Seq on known synthetic PolyA+ mRNAs from the External RNA Controls Consortium (ERCC) alone and in mixtures with PolyA+ mRNA from Drosophila S2 cells. ERCC mRNAs were obtained under Phase V testing from the National Institutes of Standards and Technology (NIST). The ERCC pool contained 96 species of mRNA of various lengths and GC content covering a 2^20 concentration range. Libraries were constructed using 100ng S2 mRNA with 5ng, 2.5ng, or 1ng ERCC mRNAs, and using 50ng ERCC mRNA without S2 cell mRNA. Our data shows an outstanding linear fit between RNA-Seq read density and known input amounts.

2010-04-19 | GSE20579 | GEO

Project description:Acinetobacter baumannii strains from a public academic hospital in Gauteng, South Africa

| PRJNA765178 | ENA

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

2009-06-03 | GSE14695 | GEO

Project description:GIAB FASTQ files

| PRJNA1257936 | ENA

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data