Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA248619 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:RNA-Seq after Cas9-gRNA transfection with different length gRNAs we performed PolyA Selection and RNA-Seq on cells transfected with dCas9-VPR and a gRNA of each length (20nt, 16nt, or 14nt) targeting ACTC1, MIAT, or HBG1/2
2015-07-15 | E-GEOD-70694 | biostudies-arrayexpress
Project description:Sequencing of CRISPR-CAs9 and TALEN targeted HUES9 clones
| PRJNA240654 | ENA
Project description:We have sequenced miRNA libraries from human embryonic, neural and foetal mesenchymal stem cells. We report that the majority of miRNA genes encode mature isomers that vary in size by one or more bases at the 3’ and/or 5’ end of the miRNA. Northern blotting for individual miRNAs showed that the proportions of isomiRs expressed by a single miRNA gene often differ between cell and tissue types. IsomiRs were readily co-immunoprecipitated with Argonaute proteins in vivo and were active in luciferase assays, indicating that they are functional. Bioinformatics analysis predicts substantial differences in targeting between miRNAs with minor 5’ differences and in support of this we report that a 5’ isomiR-9-1 gained the ability to inhibit the expression of DNMT3B and NCAM2 but lost the ability to inhibit CDH1 in vitro. This result was confirmed by the use of isomiR-specific sponges. Our analysis of the miRGator database indicates that a small percentage of human miRNA genes express isomiRs as the dominant transcript in certain cell types and analysis of miRBase shows that 5’ isomiRs have replaced canonical miRNAs many times during evolution. This strongly indicates that isomiRs are of functional importance and have contributed to the evolution of miRNA genes
2014-08-06 | GSE58734 | GEO
Project description: Not available
| S-EPMC2531291 | biostudies-literature
Project description:RNA extracted at 240min. Samples are rRNA depleted. Expression measurement of Homo sapiens genes.
2019-07-31 | GSE114179 | GEO
Project description: Not available
| S-EPMC4686780 | biostudies-literature
Project description:Cas9 gRNA engineering for selectable genome editing, activation and repression
| PRJNA289388 | ENA
Project description: Not available
| S-EPMC3743458 | biostudies-literature
Project description:Gene expression profiling of immortalized human mesenchymal stem cells with hTERT/E6/E7 transfected MSCs. hTERT may change gene expression in MSCs. Goal was to determine the gene expressions of immortalized MSCs.
2010-09-25 | GSE24338 | GEO