Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Synthetic metagenome

ABSTRACT: Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

PROVIDER: PRJNA324163 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR3706800.fastq.gz	Fastqsanger.gz
	SRR3706799.fastq.gz	Fastqsanger.gz
	SRR3832170_1.fastq.gz	Fastqsanger.gz
	SRR3832170_2.fastq.gz	Fastqsanger.gz
	SRR3832180_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 249

Similar Datasets

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

2009-06-03 | GSE14695 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:High throughput 16S rRNA amplicon sequencing

| PRJNA751915 | ENA

synthetic construct

Project description:Representing genetic variation with synthetic DNA standards

| PRJNA321434 | ENA

Project description:High-throughput 16S rRNA gene sequencing

| PRJNA1014794 | ENA

Project description:High-throughput 16S rRNA gene sequencing

| PRJNA1014803 | ENA

Project description:16S rRNA gene high-throughput sequencing

| PRJNA1237414 | ENA