Food metagenome
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA343503 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR4308710_1.fastq.gz | Fastqsanger.gz | |||
| SRR4333334_1.fastq.gz | Fastqsanger.gz | |||
| SRR4340310_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 3 of 3 |
Similar Datasets
Project description:S. meliloti strains with a bi- and monopartite genome configuration were constructed by consecutive Cre/lox-mediated site-specific fusions of the secondary replicons. Beside the correct genomic arrangements, these strains and precursors were tested for variations in the nucleotide sequence. Futher, a marker fequency analysis was performed to test if replication is initiated at all origins and to determine the replication termination regions of the triple replicon fusion molecule. To gain the sequence data for these analyses, respective strains were applied to whole genome sequencing using an Illumina MiSeq-System and Oxford Nanopore (MinION) sequencing technology.
2024-09-30 | E-MTAB-11878 | biostudies-arrayexpress
Project description:To evaluate targeted MinION next generation sequencing as a diagnostic method for detection of pathogens in human blood and plasma, human blood or plasma samples were spiked with measured amounts of viruses, bacteria, protozoan parasites or tested pathogen-free as negative controls. Nucleic acid was extracted from samples and PCR amplification performed in multiplex primer pools with a procedure described in ArrayExpress experiment submission ID 18379. The PCR products were used for library preparation. The libraries sequenced on an Oxford Nanopore MinION. The passed reads aligned with a custom reference file to determine the identity of the pathogen in the sample.
2024-06-08 | E-MTAB-14011 | biostudies-arrayexpress
Project description:Transposon insertion site sequencing (TIS) is a powerful method for associating genotype to phenotype. However, all TIS methods described to date use short nucleotide sequence reads which cannot uniquely determine the locations of transposon insertions within repeating genomic sequences where the repeat units are longer than the sequence read length. To overcome this limitation, we have developed a TIS method using Oxford Nanopore sequencing technology that generates and uses long nucleotide sequence reads; we have called this method LoRTIS (Long Read Transposon Insertion-site Sequencing). This experiment data contains sequence files generated using Nanopore and Illumina platforms. Biotin1308.fastq.gz and Biotin2508.fastq.gz are fastq files generated from nanopore technology. Rep1-Tn.fastq.gz and Rep1-Tn.fastq.gz are fastq files generated using Illumina platform. In this study, we have compared the efficiency of two methods in identification of transposon insertion sites.
2022-05-30 | E-MTAB-11351 | biostudies-arrayexpress
Project description:We applied direct RNA long read sequencing for characterization of transcripts from constructs inserted into HEK293T mammalian cells with different promoters. Direct RNA sequencing was performed on an Oxford Nanopore GridION device using the Direct Sequencing Kit (SQK-RNA004, date accessed 15 May 2024), MinION RNA flow cell (FLO-MIN00RA), and data pre-processing was performed with MinKNOW (v24.06.10).
2025-06-19 | GSE283443 | GEO
Project description:In this experiment we wanted to see how the binding behavior of the S. Cerevisiae transcription factor Leu3, on of the main regulators of leucine biosynthesis, is affected by different availability of the branched chain amino acids. For this we grow the cells in shake flask under glucose limitation and treated them 2 hours before sampling. The cells were then cross-linked with formaldehyde and ChIP-seq was performed using the Oxford Nanopore MinIon.
2020-07-01 | E-MTAB-8820 | biostudies-arrayexpress
Project description:Sequencing was performed to assess the ability of Nanopore direct cDNA and native RNA sequencing to characterise human transcriptomes. Total RNA was extracted from either HAP1 or HEK293 cells, and the polyA+ fraction isolated using oligodT dynabeads. Libraries were prepared using Oxford Nanopore Technologies (ONT) kits according to manufacturers instructions. Samples were then sequenced on ONT R9.4 flow cells to generate fast5 raw reads in the ONT MinKNOW software. Fast5 reads were then base-called using the ONT Albacore software to generate Fastq reads.
2019-03-14 | E-MTAB-7778 | biostudies-arrayexpress
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:Higher-order chromatin structure arises from the combinatorial physical interactions of many genomic loci. To investigate this aspect of genome architecture we developed Pore-C, which couples chromatin conformation capture with Oxford Nanopore Technologies (ONT) long reads to directly sequence multi-way chromatin contacts without amplification.
2022-05-12 | GSE149117 | GEO
Project description:This dataset contains:
1) Raw FASTQ and BAM files for short reads. Here, DNA libraries were prepared using Nextera Rapid Capture Custom Enrichment kit (Illumina) and paired-end sequenced on a HiSeq2500 (Illumina).
2) Raw FASTQ and BAM files for long reads. Here, DNA libraries were prepared using 1D DNA ligation Sequencing Kit (SQK-LSK109, Oxford Nanopore) and single-end sequenced on a MinION device (Oxford Nanopore).
| EGAD00001006916 | EGA
Project description:Healthy plants are vital for successful, long-duration missions in space, as they provide the crew with life support, food production, and psychological benefits. The microorganisms that associate with plant tissues play a critical role in improving plant growth, health, and production. To that end, it is necessary to develop methodologies that investigate the metabolic activities of the plant’s microbiome in orbit to enable rapid responses regarding the care of plants in space. In this study, we developed a protocol to characterize the endophytic and epiphytic microbial metatranscriptome of red romaine lettuce, a key salad crop that was grown under International Space Station (ISS)-like conditions. Microbial transcripts enriched from host-microbe total RNA were sequenced using the Oxford Nanopore MinION sequencing platform. Results showed that this enrichment approach was highly reproducible and effective for rapid on-site detection of microbial transcriptional activity. Taxonomic analysis based on 16S and 18S rRNA transcripts identified that the top five most abundant phyla in the lettuce microbiome were Firmicutes, Proteobacteria, Actinobacteria, Bacteroidetes, and Ascomycota. The metatranscriptomic analysis identified the expression of genes involved in many metabolic pathways, including carbohydrate metabolism, energy metabolism, and signal transduction. Network analyses of the expression data show that, within the signal transduction pathway of the fungal community, the Mitogen-Activated Protein Kinase signaling pathway was tightly regulated across all samples and could be a potential driver for fungal proliferation. Our results demonstrated the feasibility of using MinION-based metatranscriptomics of enriched microbial RNA as a method for rapid, on-site monitoring of the transcriptional activity of crop microbiomes, thereby helping to facilitate and maintain plant health for on-orbit space food production.
2021-06-20 | GSE152914 | GEO