Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.
Project description:MicroRNAs (miRNAs) are small regulatory RNA molecules that modulate the activity of specific mRNA targets and play important roles in a wide range of physiologic and pathologic processes. We hypothesized that miRNAs might be involved in the progression of CKD. In our previous studies we found chronic renal damages developed progressively in rats with 5/6 nephrectomy. L-mimosine(L-Mim) intervention from wk 5 to wk 12 improved renal function and resulted in additional accumulation of HIF-1 α and -2 α at wk 12. In the current study we found miR-29c was up-regulated in the L-Mim treated group compared with the control using Agilent miRNA microarrays. Of the microRNAs and proteins that exhibited reciprocal changes in expression following the L-Mim treatment, miR-29c and tropomyosin 1α (TPM1), which is involved in stress fiber function, met the sequence criteria for microRNA-target interaction, were later confirmed by 3'-untranslated region reporter analysis. TGFβ1 treatment (3 ng/ml, 24 hours) decreased miR-29c expression and up-regulated protein expression of TPM1 in human renal epithelial cells. Overexpression of miR-29c significantly attenuated TGF-β1 induced increase in TPM1 in vitro. Moreover, intrarenal expression of miR-29c was decreased in IgAN patients with moderate to severe tubulointerstital fibrosis (TIF), compared with IgAN patients without TIF, and intrarenal protein expression of TMP1 was significantly increased in IgAN patients with TIF. The results suggest that intrarenal expression of miR-29c was down-regulated while its predicted target, TPM1 was up-regulated in the progression of CKD. Short term stabilizing of HIF up-regulates miR-29c and attenuates CKD in the remnant kidney model.
Project description:Idiopathic pulmonary fibrosis (IPF) is an irreversible lung condition that progresses over time, which ultimately results in respiratory failure and mortality. In this study, we found that PLAC8 was downregulated in the lungs of IPF patients based on GEO data, in bleomycin (BLM)-induced lungs of mice, and in primary murine alveolar epithelial type II (pmATII) cells and human lung epithelial cell A549 cells. Overexpression of PLAC8 facilitated autophagy and inhibited apoptosis of pmATII cells and A549 cells in vitro. Moreover, inhibition of autophagy or overexpression of p53 partially abolished the effects of PLAC8 on cell apoptosis. ATII cell-specific overexpression of PLAC8 alleviated BLM-induced pulmonary fibrosis in mice. Mechanistically, PLAC8 interacts with VCP-UFD1-NPLOC4 complex to promote p53 degradation and facilitate autophagy, resulting in inhibiting apoptosis of alveolar epithelial cells and attenuating pulmonary fibrosis. In summary, these findings indicate that PLAC8 may be a key target for therapeutic interventions in pulmonary fibrosis.
Project description:MicroRNAs (miRNAs) are small regulatory RNA molecules that modulate the activity of specific mRNA targets and play important roles in a wide range of physiologic and pathologic processes. We hypothesized that miRNAs might be involved in the progression of CKD. In our previous studies we found chronic renal damages developed progressively in rats with 5/6 nephrectomy. L-mimosine(L-Mim) intervention from wk 5 to wk 12 improved renal function and resulted in additional accumulation of HIF-1 M-NM-1 and -2 M-NM-1 at wk 12. In the current study we found miR-29c was up-regulated in the L-Mim treated group compared with the control using Agilent miRNA microarrays. Of the microRNAs and proteins that exhibited reciprocal changes in expression following the L-Mim treatment, miR-29c and tropomyosin 1M-NM-1 (TPM1), which is involved in stress fiber function, met the sequence criteria for microRNA-target interaction, were later confirmed by 3'-untranslated region reporter analysis. TGFM-NM-21 treatment (3 ng/ml, 24 hours) decreased miR-29c expression and up-regulated protein expression of TPM1 in human renal epithelial cells. Overexpression of miR-29c significantly attenuated TGF-M-NM-21 induced increase in TPM1 in vitro. Moreover, intrarenal expression of miR-29c was decreased in IgAN patients with moderate to severe tubulointerstital fibrosis (TIF), compared with IgAN patients without TIF, and intrarenal protein expression of TMP1 was significantly increased in IgAN patients with TIF. The results suggest that intrarenal expression of miR-29c was down-regulated while its predicted target, TPM1 was up-regulated in the progression of CKD. Short term stabilizing of HIF up-regulates miR-29c and attenuates CKD in the remnant kidney model. Four weeks after 5/6 nephrectomy, rats were treated with intraperitoneal injections of vehicle or L-mimosine (L-Mim, Calbiochem), a prolyl 4-hydroxylase inhibitor (PHD), at a dosage of 50 mg/kg every other day. At the end of wk 12 after 5/6 nephrectomy, all rats (n=4, for each group) were sacrificed and blood samples were collected via cardiac puncture. Renal tissue were harvested, one piece of which was fixed in neutral formalin and then embedded in paraffin. The remaining kidney tissue was dissected in ice-cold PBS to, remove medulla, and then snap-frozen in liquid nitrogen before transferring to storage at -80M-BM-0C until further analysis.
Project description:The successful repair of alveolar epithelial injury is required to restore the integrity of gas exchanging regions of the lung and preserve organ function. Severe pulmonary fibrosis is the result of repeated episodes of epithelial injury, activation of fibroblasts, and matrix accumulation. Thus, impaired alveolar epithelial progenitor cell renewal could contribute to the progression of fibrosis. We provide evidence that expression of TLR4 and hyaluronan (HA) on Type 2 alveolar epithelial cells (AEC2s) is necessary for self-renewal. Either deletion of TLR4 or HA synthase 2 leads to impaired regeneration of AEC2s, severe fibrosis and mortality, in part due to blunted production of IL-6. AEC2s from patients with pulmonary fibrosis have reduced cell surface HA, and impaired renewal capacity, suggesting that interactions between HA and TLR4 are key regulators of lung stem cell renewal, repair of lung injury and that severe pulmonary fibrosis is the result of epithelial stem cell failure. We used microarrays to detail the gene expression of AEC2 cells from WT and TLR4-/- mice.
2016-10-03 | GSE68704 | GEO
Project description:MiR-125b-5p alleviates pulmonary fibrosis by inhibiting epithelial-mesenchymal transition via targeting BAK1
Project description:Purpose: to detect expression profile of differentially expressed mRNAs during bovine mammary epithelial cells line (MAC-T) transfected with miR-29c inhibitor or negative control (NC) inhibitor in vitro. Methods: bovine mammary epithelial cells were transfected with miR-29c inhibitor or negative control (NC) inhibitor to assess the expression profiles of mRNAs using RNA-seq. Results: a total of 42 up-regulated and 27 down-regulated mRNAs were found in the miR-29c inhibitor transfected group compared with the NC inhibitor group. Conclusion: the inhibition of miR-29c in MAC-T cells could lead to the up-regulation of 42 mRNAs and the down-regulation of 27 mRNAs. The functional enrichment of the differentially expressed mRNAs indicated that miR-29c might be a potential regulator of oxidative stress and inflammatory response in MAC-T through multiple genes, such as FOXO1, TNF-α and BoLA-DQA5, which enriched in stress-activated MAPK cascade, Epstein-Barr virus infection and inflammatory bowel disease signaling pathways. The above results imply that miR-29c plays an important role in the steady state of bMECs or bovine mammary glands and may be a potential therapeutic target for mastitis in dairy cows.
Project description:Pulmonary fibrosis is often triggered by an epithelial injury resulting in the formation of fibrotic lesions in the lung, which progress to impair gas exchange and ultimately cause death. Recent clinical trials using drugs that target either inflammation or a specific molecule have failed, suggesting that multiple pathways and cellular processes need to be attenuated for effective reversal of established and progressive fibrosis. Although activation of MAPK and PI3K pathways have been detected in human fibrotic lung samples, the therapeutic benefits of in vivo modulation of the MAPK and PI3K pathways in combination are unknown. Overexpression of TGF? in the lung epithelium of transgenic mice results in the formation of fibrotic lesions similar to those found in human pulmonary fibrosis, and previous work from our group shows that inhibitors of either the MAPK or PI3K pathway can alter the progression of fibrosis. In this study, we sought to determine whether simultaneous inhibition of the MAPK and PI3K signaling pathways is a more effective therapeutic strategy for established and progressive pulmonary fibrosis. Our results showed that inhibiting both pathways had additive effects compared to inhibiting either pathway alone in reducing fibrotic burden, including reducing lung weight, pleural thickness, and total collagen in the lungs of TGF? mice. This study demonstrates that inhibiting MEK and PI3K in combination abolishes proliferative gene changes associated with fibrosis and myfibroblast accumulation and thus may serve as a therapeutic option in the treatment of human fibrotic lung disease where these pathways play a role. mRNA profiles of CCSP/TGFalpha mice treated with vehicle, ARRY, PX-866, ARRY/PX-866
Project description:To explain the mechanism that miR-29c affects the cell proliferation, we attempted to identify the miR-29c target genes in gastric carcinoma. The expression profiles in MKN45, MKN7 and MKN74 cells transfected with miR-29c oligo or Negative control oligo were obtained from microarray analysis. Then, the genes differentially expressed (Fold change >= 2.0) in miR-29c-transfected cells compared with negative control-transfected ones were identified in each cell lines, respectively. The differentially expressed genes shared among 3 cell lines were identified as the candidates for miR-29c targets.