Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:Microplastics (MPs) as widespread contamination pose high risk for aquatic organisms.Intestinal microbiotahas have high interaction with immune system of host body. In this study, intestinal microbiota of zebrafish after Polystyrene (PS-MPs) exposure were characterized by 16S rDNA amplicon sequencing. We found that 100nm and 200μm PS-MPs exposure significantly increased diversity of intestinal microbiota and all the three sizes of PS-MPs increased abundance of pathogenic bacteria.
2019-10-01 | GSE136108 | GEO
Project description:16S rDNA High throughput sequencing of soil
| PRJNA638003 | ENA
Project description:16S rDNA High throughput sequencing of soil
| PRJNA728746 | ENA
Project description:Characterization of Microbial Communities in Five Traditional Chinese Medicines Using High-Throughput 16s rRNA Sequencing
Project description:Transcription profiling by high throughput sequencing of wheat cultivar Chinese Spring seedlings maintained without phosphate for 10 days
Project description:The traditional Chinese medical formulas have been in clinical use for thousands of years and their therapeutic effects were documented in ancient Chinese pharmacopoeias. High-throughput biological analysis on cell line models has been demonstrated as a useful alternative to elucidate intricate molecular mechanisms associated with drug actions in a number of pharmacogenomic studies. This microarray study is aimed to provide a reliable and feasible means to explore the healing philosophy of Chinese herbalism. Keywords: Pharmacogenetics
Project description:Two parallel anaerobic digestion lines were designed to match a "bovid-like" digestive structure. Each of the lines consisted of two Continuous Stirred Tank Reactors placed in series and separated by an acidic treatment step. The first line was inoculated with industrial inocula whereas the second was seeded with cow digestive tract contents. After three month of continuous sewage sludge feeding, samples were recovered for shotgun metaproteomic and DNA-based analysis. Strikingly, protein inferred and 16S rDNA tags based taxonomic community profiles were not fully consistent. Principal Component analysis however revealed a similar clustering pattern of the samples, suggesting that reproducible methodological and/or biological factors underlie this observation. The performances of the two digestion lines did not differ significantly and the cow derived inocula did not establish in the reactors. A low throughput metagenomic dataset (3.4x106 reads, 1.1 Gb) was also generated for one of the samples. It allowed a substantial increase of the analysis depth (increase of the spectral identification rate). For the first time, a high level of proteins expressed by members of the "Candidatus Competibacter" group is reported in an anaerobic digester, a key microbial player in environmental bioprocess communities.