Ontology highlight
ABSTRACT:
PROVIDER: PRJNA422341 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR6374811.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 1 of 1 |
Similar Datasets
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Deep mutational scanning is a powerful method for exploring the mutational fitness landscape of proteins. Its adaptation to anti-CRISPR proteins, which are natural CRISPR-Cas inhibitors and key players in the co-evolution of microbes and phages, facilitates their characterization and optimization. Here, we developed a robust anti-CRISPR deep mutational scanning pipeline in Escherichia coli that combines synthetic gene circuits based on CRISPR interference with flow cytometry coupled sequencing and mathematical modeling. Using this pipeline, we characterized comprehensive single point mutation libraries for AcrIIA4 and AcrIIA5, two potent inhibitors of CRISPR-Cas9. The resulting mutational fitness landscapes revealed considerable mutational tolerance for both Acrs, suggesting an intrinsic redundancy with respect to Cas9 inhibitory features, and – for AcrIIA5 – indicated mutations that boost Cas9 inhibition. Subsequent in vitro characterization suggested that the observed differences in inhibitory potency between mutant inhibitors were mostly due to changes in binding affinity rather than protein expression levels. Finally, to demonstrate that our pipeline can inform Acrs-based genome editing applications, we employed a selected subset of mutant inhibitors to increase CRISPR-Cas9 target specificity by modulating Cas9 activity. Taken together, our work establishes deep mutational scanning as a powerful method for anti-CRISPR protein characterization and optimization.
2024-03-01 | GSE254101 | GEO
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM).
2014-08-29 | GSE57650 | GEO
Project description:Regulation and functionality of species-specific alternative splicing has remained enigmatic for many years. Calcium/calmodulin-dependent protein kinase IIβ (CaMKIIβ) is expressed in several splice variants and plays a key role in learning and memory. Here, we identify and characterize several primate-specific CAMK2B splice isoforms, which show altered kinetic properties and changes in substrate specificity. Furthermore, we demonstrate that primate-specific Camk2β alternative splicing is achieved through branch point weakening during evolution. We show that reducing branch point and splice site strength during evolution globally renders constitutive exons alternative, thus providing a paradigm for cis-directed species-specific alternative splicing regulation. Using CRISPR/Cas9 we introduced the weaker human branch point into the mouse genome, resulting in human-like CAMK2B splicing in the brain of mutant mice. We observe a strong impairment of long-term potentiation in CA3-CA1 synapses of mutant mice, thus connecting branch point-controlled, species-specific alternative splicing with a fundamental function in learning and memory.
2022-12-19 | PXD035346 | Pride
Project description:Based on the hypothesis that, enhancing the local concentration of donor oligos could increase the correction rates, we generated and tested novel CRISPR-Cas9 systems, in which the DNA repair template is covalently conjugated to Cas9 (RNPD system). To validate our results from the HEK293T reporter cells, we here tested our approach at different endogenous genomic loci and in different cell types. We first targeted the human beta globin (HBB) locus in the K562 cell line, and analyzed correction- and editing frequencies using next generation sequencing (NGS). Next we targeted the Rosa26 and proprotein convertase subtilisin/kexin type 9 (Pcsk9) locus in mouse embryonic stem cells (mESCs). Here, RNPD system was always compared to Cas9 SNAP-tag fusion proteins with uncoupled donor oligos. To also directly compare the engineered RNPD system to the classical CRISPR-Cas9 system, we performed experiments where we used wild-type Cas9 with the uncoupled donor oligos as a control. We therefore targeted the fluorescent reporter locus as well as the endogenous loci HBB, empty spiracles homeobox 1 (EMX1), and C-X-C chemokine receptor type 4 (CXCR4) in HEK293T cells. Finally, we performed the analysis of three computationally predicted off-target sites of the reporter locus.
2018-06-04 | E-MTAB-6808 | biostudies-arrayexpress
Project description:Eukaryotic-driven directed evolution of Cas9 nucleases
| PRJNA1020659 | ENA
Project description:Regulation and functionality of species-specific alternative splicing has remained enigmatic for many years. Calcium/calmodulin-dependent protein kinase IIβ (CaMKIIβ) is expressed in several splice variants and plays a key role in learning and memory. Here, we identify and characterize several primate-specific CAMK2B splice isoforms, which show altered kinetic properties and changes in substrate specificity. Furthermore, we demonstrate that primate-specific Camk2β alternative splicing is achieved through branch point weakening during evolution. We show that reducing branch point and splice site strength during evolution globally renders constitutive exons alternative, thus providing a paradigm for cis-directed species-specific alternative splicing regulation. Using CRISPR/Cas9 we introduced the weaker human branch point into the mouse genome, resulting in human-like CAMK2B splicing in the brain of mutant mice. We observe a strong impairment of long-term potentiation in CA3-CA1 synapses of mutant mice, thus connecting branch point-controlled, species-specific alternative splicing with a fundamental function in learning and memory.
2022-12-02 | GSE208181 | GEO
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress