Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Covalent linkage of the DNA repair template to the CRISPR-Cas9 nuclease enhances homology-directed repair

ABSTRACT: Based on the hypothesis that, enhancing the local concentration of donor oligos could increase the correction rates, we generated and tested novel CRISPR-Cas9 systems, in which the DNA repair template is covalently conjugated to Cas9 (RNPD system). To validate our results from the HEK293T reporter cells, we here tested our approach at different endogenous genomic loci and in different cell types. We first targeted the human beta globin (HBB) locus in the K562 cell line, and analyzed correction- and editing frequencies using next generation sequencing (NGS). Next we targeted the Rosa26 and proprotein convertase subtilisin/kexin type 9 (Pcsk9) locus in mouse embryonic stem cells (mESCs). Here, RNPD system was always compared to Cas9 SNAP-tag fusion proteins with uncoupled donor oligos. To also directly compare the engineered RNPD system to the classical CRISPR-Cas9 system, we performed experiments where we used wild-type Cas9 with the uncoupled donor oligos as a control. We therefore targeted the fluorescent reporter locus as well as the endogenous loci HBB, empty spiracles homeobox 1 (EMX1), and C-X-C chemokine receptor type 4 (CXCR4) in HEK293T cells. Finally, we performed the analysis of three computationally predicted off-target sites of the reporter locus.

INSTRUMENT(S): Illumina MiSeq

ORGANISM(S): Mus musculus

SUBMITTER: Helen Lindsay

PROVIDER: E-MTAB-6808 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Covalent linkage of the DNA repair template to the CRISPR-Cas9 nuclease enhances homology-directed repair.

Savic Natasa N Ringnalda Femke Cas FC Lindsay Helen H Berk Christian C Bargsten Katja K Li Yizhou Y Neri Dario D Robinson Mark D MD Ciaudo Constance C Hall Jonathan J Jinek Martin M Schwank Gerald G

eLife 20180529

The CRISPR-Cas9 targeted nuclease technology allows the insertion of genetic modifications with single base-pair precision. The preference of mammalian cells to repair Cas9-induced DNA double-strand breaks via error-prone end-joining pathways rather than via homology-directed repair mechanisms, however, leads to relatively low rates of precise editing from donor DNA. Here we show that spatial and temporal co-localization of the donor template and Cas9 via covalent linkage increases the correctio ...[more]

PMID: 29809142

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Covalent linkage of the DNA repair template to the CRISPR-Cas9 nuclease enhances homology-directed repair

Publications

Covalent linkage of the DNA repair template to the CRISPR-Cas9 nuclease enhances homology-directed repair.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure