Project description:Drought stress is the main factor restricting maize yield. Poly-γ-glutamic acid (γ-PGA) could significantly improve the drought resistance and yield of many crops. However, its high production costs and unclear long-term impact on soil ecology limit its large-scale application. In this study, genes (PgsA, B, C) that participate in γ-PGA synthesis were cloned from Bacillus amyloliquefaciens and transformed into maize for the first time. Under drought stress, transgenic maize significantly increased the ear length, ear weight and grain weight by 50% compared to the control, whereas the above yield characteristics increased by 2.33, 13.06, 19.34 and 18.36%, respectively under normal growth conditions. γ-PGA was mainly expressed in the mesophyll cells of maize leaf rosette structure and improved drought resistance and yield by protecting and increasing the expression of genes for the photosynthetic and carbon fixation. This study is an important exploration for maize drought stress molecular breeding and building resource-saving agriculture.
Project description:The gene expression levels in murine bone marrow-derived dendritic cells treated with γ-PGA NPs were examined by oligonucleitide microarray and compared with those in the cells treated with other adjuvants. The gene expression of proinflammatory chemokines, cytokines, and costimulatory molecules was upregulated considerably in DCs treated with γ-PGA NPs. The upregulation pattern was similar to that in DCs treated with LPS but not in DCs treated with unparticulate γ-PGA. The activation of DCs by γ-PGA NPs was confirmed by real-time RT-PCR analysis for the genes related to TLR signaling. The effect of γ-PGA NPs on DCs was not annihilated by treating with polymixin B, an inhibitor of LPS. Furthermore, the immunization of mice with γ-PGA NPs carrying OVA significantly induced Ag-specific CD8+ T cells and Ag-specific production of IL-2, TNF-α, and IFN-γ from the cells. Such activities of γ-PGA NPs were more prominent, when compared to the immunization with OVA plus aluminum hydroxide or OVA plus CFA. These results suggest that γ-PGA NPs induce a CD8+ T cell response through activating innate immunity in a fashion different from that of LPS. Thus, γ-PGA NPs may be an attractive adjuvant to be further developed for vaccine therapy.
Project description:The industrially attractive biopolymer Poly-γ-glutamic acid (γ-PGA) is commonly produced by species of the genus Bacillus by co-feeding different carbon- and nitrogen sources. Recent studies have highlighted the pivotal role of co-metabolization of a rapidly degradable carbon source such as glycerol together with citrate for γ-PGA production, independently fueling biomass generation as well as TCA cycle precursor supply. With this study, we report that the sole presence of citrate in the production medium greatly influences growth behavior, γ-PGA production, and the viscosity of microbial cultures during biopolymer synthesis. Independent of the citrate concentration in the medium. only minor amounts of citrate were imported by B. subtilis 168 in presence of glycerol due to carbon catabolite repression. However, a high citrate concentration resulted in a 6-fold increase in γ-PGA titer as compared to low levels of exogenous citrate. Data suggests that citrate was not used as a precursor in γ-PGA synthesis but rather influenced the fate of imported glutamate. The citrate concentration also affected medium viscosity as depletion resulted in a remarkable spike in broth viscosity. Additionally, cellular proteome analysis at different levels of citrate availability revealed significant changes in protein abundance involved in motility and fatty acid degradation
Project description:The gene expression levels in murine bone marrow-derived dendritic cells treated with γ-PGA NPs were examined by oligonucleitide microarray at 6, 12 and 24 hours. The gene expression of proinflammatory chemokines, cytokines, and costimulatory molecules was upregulated considerably in DCs treated with γ-PGA NPs at 6 hours.
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
Project description:We investigated the changes in soil microorganisms and their metabolic processes under microplastic pollution by adding different types and concentrations of microplastics (polypropylene plastic, polyethylene terephthalate plastic, polyhexanediol/caprolactone microplastics) to agricultural soil.
Project description:Clinical isolates of the porcine pathogen Actinobacillus pleuropneumoniae often form adherent colonies on agar plates due to expression of an operon, pgaABCD, encoding a poly-N-acetylglucosamine (PGA) extracellular matrix. The adherent colony phenotype, which correlates with the ability to form a biofilm on the surface of polystyrene plates, is lost following serial passage in broth culture, and repeated passage of the non-adherent variants on solid media does not result in reversion to the adherent colony phenotype. In order to investigate the regulation of PGA expression and biofilm formation in A. pleuropneumoniae, we screened a bank of transposon mutants of the non-adherent serovar 1 strain, S4074T, and identified mutations in two genes, rseA and hns, which resulted in formation of the adherent colony phenotype. In other bacteria, including the Enterobacteriaceae, H-NS acts as a global gene regulator, and RseA is a negative regulator of the extracytoplasmic stress response sigma factor, ?E. Transcription profiling of A. pleuropneumoniae rseA and hns mutants revealed that both ?E and H-NS independently regulate expression of the pga operon. Transcription of the pga operon is initiated from a ?E promoter site in the absence of H-NS, and up-regulation of ?E is sufficient to displace H-NS, allowing transcription to proceed. In A. pleuropneumoniae, H-NS does not act as a global gene regulator, but rather specifically regulates biofilm formation via repression of the pga operon. Positive regulation of the pga operon by ?E indicates that biofilm formation in is part of the extracytoplasmic stress response in A. pleuropneumoniae.