Project description:Using ChIP-Seq we examined the targets of FoxH1 in zebrafish embryos at the 6hpf epiboly-stage. The revealed reads could be mapped to more than 16,000 peaks included also the known targets like ndr1, lft2, pitx2, flh, foxa3 and lhx1a. Relevant for our study, we identify the conserved microRNA-430 family (miR-430) as a novel target of FoxH1.
Project description:MicroRNAs comprise 1-3% of all vertebrate genes, but their in vivo functions and mechanisms of action remain largely unknown. Zebrafish miR-430 is expressed at the onset of zygotic transcription and regulates morphogenesis during early development. Using a microarray approach and in vivo target validation, we find that miR-430 directly regulates several hundred target mRNAs. Targets are highly enriched for maternal mRNAs that accumulate in the absence of miR-430. We also show that miR-430 accelerates the deadenylation of target mRNAs. These results suggest that miR-430 facilitates the deadenylation and clearance of maternal mRNAs during early embryogenesis. Keywords: Dicer, MZdicer, miR-430, miRNA target, maternal, zygotic
Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.
Project description:Morphogen gradients expose cells to different signal concentrations and induce target genes with different ranges of expression. To determine how the Nodal morphogen gradient induces distinct gene expression patterns during zebrafish embryogenesis we characterized the binding sites of the Nodal-specific transcription co-activators Smad2 and FoxH1 in wild-type, Nodal-overexpressing or Nodal signaling inhibited embryos. We found that FoxH1 binds to Nodal targets loci even in the absence of the signal, while Smad2 only binds and colocalizes to FoxH1 upon induction of the Nodal pathway.
Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation. ChIP-seq of Smad2/3 and Input in X.tropicalis, stage 10.5 embryo.
Project description:Precise gene expression patterns, both in time and space, is required for developmental processes to properly progress. Early embryonic cell fates are specified through the coordinated integration of transcription factor activities and epigenetic states of the genome. Foxh1 is a key maternal transcription factor controlling the mesendodermal gene regulatory program. Proteomic interactome analyses using FOXH1 as a bait in mouse embryonic stem cells revealed that FOXH1 interacts with PRC2 subunits and Hdac1. Foxh1 physically interacts with Hdac1, and confers transcriptional repression of mesendodermal genes in the ectoderm. Our findings reveal a central role of Foxh1 in coordinating the chromatin states of the Xenopus embryonic genome.
Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation.