Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: High throughput 16S rRNA gene amplicon sequencing of vertical core of on-site wastewater treatment system at high resolution

PROVIDER: PRJNA576274 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR10245500_1.fastq.gz	Fastqsanger.gz
	SRR10245500_2.fastq.gz	Fastqsanger.gz
	SRR10245501_1.fastq.gz	Fastqsanger.gz
	SRR10245501_2.fastq.gz	Fastqsanger.gz
	SRR10245502_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 108

Similar Datasets

Project description:High throughput 16S rRNA gene amplicon sequencing of three on-site wastewater treatment systems

| PRJNA553795 | ENA

Project description:High throughput 16S rRNA gene amplicon sequencing of two treatments in on-site wastewater treatment system (OWTS) laboratory experiment

| PRJNA553796 | ENA

Project description:High throughput 16S rRNA gene amplicon sequencing of laboratory on-site wastewater systems, sterile sand material

| PRJNA612859 | ENA

Project description:High throughput 16S rRNA gene amplicon sequencing of laboratory on-site wastewater systems, aged woodchip material

| PRJNA612866 | ENA

Project description:High throughput 16S rRNA amplicon sequencing

| PRJNA751915 | ENA

Project description:wastewater treatment plant influents_16S rRNA gene-high throughput sequqencing

| PRJNA449806 | ENA

Overall functional diversity of microbial communities in three full-scale activated sludge bioreactors

Project description:Understanding microbial community diversity is thought to be crucial for improving process functioning and stabilities of wastewater treatment systems. However, current studies largely focus on taxonomic groups based on 16S rRNA, which are not necessarily linked to functioning, or a few selected functional genes. Here we launched a study to profile the overall functional genes of microbial communities in three full-scale wastewater treatment systems. Triplicate activated sludge samples from each system were analyzed using a high-throughput metagenomics tool named GeoChip 4.2, resulting in the detection of 38,507 to 40,647 functional genes. A high similarity of 75.5% to 79.7% shared genes was noted among the nine samples. Moreover, correlation analyses showed that the abundances of a wide array of functional genes were associated with system performances. For example, the abundances of overall nitrogen cycling genes had a strong correlation to total nitrogen (TN) removal rates (r = 0.7647, P < 0.01). The abundances of overall carbon cycling genes were moderately correlated with COD removal rates (r = 0.6515, P < 0.01). Lastly, we found that influent chemical oxygen demand (COD inf) and total phosphorus concentrations (TP inf), and dissolved oxygen (DO) concentrations were key environmental factors shaping the overall functional genes. Together, the results revealed vast functional gene diversity and some links between the functional gene compositions and microbe-mediated processes.

2014-12-31 | GSE53744 | GEO

aquifer metagenome

Project description:High-throughput 16S rRNA amplicon pyrosequencing of contaminated aquifer sediment

| PRJNA134929 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

The high-throughput sequencing data of coking wastewater OHO biological system

Project description:The high-throughput sequencing data of coking wastewater OHO biological system

| PRJNA1100173 | ENA