Ontology highlight
ABSTRACT:
PROVIDER: PRJNA594238 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR10608500_1.fastq.gz | Fastqsanger.gz | |||
| SRR10608500_2.fastq.gz | Fastqsanger.gz | |||
| SRR10608600_1.fastq.gz | Fastqsanger.gz | |||
| SRR10608600_2.fastq.gz | Fastqsanger.gz | |||
| SRR10608700_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 456 |
Similar Datasets
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
| 2255499 | ecrin-mdr-crc
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:BACKGROUND: Metagenomic studies carried out in the past decade have led to an enhanced understanding of the gut microbiome in human health, however, the Indian gut microbiome is not well explored yet. We analysed the gut microbiome of 110 healthy individuals from two distinct locations (North-Central and Southern) in India using multi-omics approaches, including 16S rRNA gene amplicon sequencing, whole genome shotgun metagenomic sequencing, and metabolomic profiling of faecal and serum samples. </br> RESULTS: The gene catalogue established in this study emphasizes the uniqueness of the Indian gut microbiome in comparison to other populations. The gut microbiome of the cohort from North-Central India, which was primarily consuming a plant-based diet, was found to be associated with Prevotella, and also showed an enrichment of Branched Chain Amino Acid (BCAA) and lipopolysaccharide (LPS) biosynthesis pathways. In contrast, the gut microbiome of the cohort from Southern India, which was consuming an omnivorous diet, showed associations with Bacteroides, Ruminococcus and Faecalibacterium, and had an enrichment of Short Chain Fatty Acid (SCFA) biosynthesis pathway and BCAA transporters. This corroborated well with the metabolomics results, which showed higher concentration of BCAAs in the serum metabolome of the North-Central cohort and an association with Prevotella. In contrast, the concentration of BCAAs were found higher in the faecal metabolome of the Southern-India cohort, and showed a positive correlation with the higher abundance of BCAA transporters. </br> CONCLUSIONS: The study reveals the unique composition of Indian gut microbiome, establishes the Indian gut microbial gene catalogue, and compares it with the gut microbiome of other populations. The functional associations revealed using metagenomic and metabolomic approaches provide novel insights on the gut-microbe-metabolic axis, which will be useful for future epidemiological and translational researches.
2019-01-04 | MTBLS803 | MetaboLights
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Swine confinement buildings (SCBs) represent workplaces with high biological air pollution. It is suspected that individual components of inhalable air are causatives of chronic respiratory disease that are regularly detected among workers. In order to understand the relationship between exposure and stress, the aim of this study was to develop a method to investigate the components of bioaerosols in more detail. For this purpose, bioaerosols from pig barns were collected on quartz filters from two exclusively housed pig types (porkers and gestating sows) and subsequently analyzed via a combinatorial approach of 16S rRNA amplicon sequencing and metaproteomics. The workflow helps to clarify diversity in bioaerosols from a taxonomic perspective, but also from a functional perspective.
2024-01-26 | PXD039685 | Pride
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
2024-03-01 | GSE254843 | GEO
Project description:Cover cropping is an effective method to protect agricultural soils from erosion, promote nutrient and moisture retention, encourage beneficial microbial activity, and maintain soil structure. Reusing winter cover crop root channels with the maize roots during the summer allows the cash crop to extract resources from farther niches in the soil horizon. In this study, we investigate how reusing winter cover crop root channels to grow maize (Zea mays L.) affects the composition and function of the bacterial communities in the rhizosphere using 16S rRNA gene amplicon sequencing and metaproteomics. We discovered that the bacterial community significantly differed among cover crop variations, soil profile depths, and maize growth stages. Re-usage of the root channels increased bacterial abundance, and it further increases as we elevate the complexity from monocultures to mixtures. Upon mixing legumes with brassicas and grasses, the overall expression of several steps of the carbon cycle (C) and the nitrogen cycle (N) improved. The deeper root channels of legumes and brassicas compared to grasses correlated with higher bacterial 16S rRNA gene copy numbers and community roles in the respective variations in the subsoil regimes due to the increased availability of root exudates secreted by maize roots. In conclusion, root channel re-use (monocultures and mixtures) improved the expression of metabolic pathways of the important C and N cycles, and the bacterial communities, which is beneficial to the soil rhizosphere as well as to the growing crops.
2025-05-02 | PXD046832 | Pride
Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.
2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress