Ontology highlight
ABSTRACT:
PROVIDER: PRJNA628962 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR11629800_1.fastq.gz | Fastqsanger.gz | |||
| SRR11629800_2.fastq.gz | Fastqsanger.gz | |||
| SRR11629801_1.fastq.gz | Fastqsanger.gz | |||
| SRR11629801_2.fastq.gz | Fastqsanger.gz | |||
| SRR11629802_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 192 |
Similar Datasets
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction A ten chip study using PCR amplicons from cloned 16S rRNA genes and from diverse soil 16S rRNAs, with PCR primers specific to the Division Acidobacteria. Each chip measures the signal from 42,194 probes (in triplicate) targeting Acidobacteria division, subdivision, and subclades as well as other bacterial phyla. All samples except one (GSM464591) include 2.5 M betaine in the hybridization buffer. Pair files lost due to a computer crash.
2010-06-24 | E-GEOD-18711 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:This study in rats was designed to investigate whether whole rhye (WR) can influence the metabolism of n-3 and n-6 long-chain fatty acids (LCFA) and gut microbiota composition. For 12 weeks, rats were fed a diet containing either 50% WR or 50% refined rye (RR). Total bacterial DNA was extracted from fecal and cecal samples (n=5 per group). 16S PCR amplification was performed to assess the microbial diversity at the family level using the HuGChip. Amplified DNA was purified and labelled with either Cy3 or Cy5 dye and hybridized on the microarray. A 15 chip study was realized, each corresponding to hybridization with 250ng of labelled 16S rRNA gene amplicons from either mice fecal and cecal samples. Each probe (4441) was synthetized in three replicates.
2015-08-06 | E-GEOD-71726 | biostudies-arrayexpress
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
2024-03-01 | GSE254843 | GEO
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:Sequencing of 16S ribosomal RNA (rRNA) gene, which has improved the characterization of microbial community, has made it possible to detect a low level Helicobacter pylori (HP) sequences even in HP-negative subjects which were determined by a combination of conventional methods. This study was conducted to obtain a cutoff value for HP colonization in gastric mucosa biopsies and gastric juices by the pyrosequencing method. Corresponding author: Department of Internal Medicine, Seoul National University Bundang Hospital, Seoungnam, Gyeonggi-do, Korea; Department of Internal Medicine and Liver Research Institute, Seoul National University College of Medicine, Seoul, Korea (Tel., +82-31-787-7008; e-mail, nayoungkim49@empas.com). Microbial DNA from gastric mucosal samples [gastric antrum (n=63, mucosal biopsy), follow-up sample on gastric antrum (n=16, mucosal biopsy), and gastric body (n=18, mucosal biopsy)] and gastric juices (n=4, not mucosal biopsy) was amplified by nested PCR using universal bacterial primers, and the 16S rRNA genes were pyrosequenced.
2014-09-18 | E-GEOD-61493 | biostudies-arrayexpress