Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

NTP4 modulates miRNA accumulation via asymmetric modification of miRNA-3p/5p duplex

ABSTRACT: NTP4 modulates miRNA accumulation via asymmetric modification of miRNA-3p/5p duplex

PROVIDER: PRJNA634468 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR11829907.fastq.gz	Fastqsanger.gz
	SRR11829908.fastq.gz	Fastqsanger.gz
	SRR11829909.fastq.gz	Fastqsanger.gz
	SRR11829910.fastq.gz	Fastqsanger.gz
	SRR11829911.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

NTP4 modulates miRNA accumulation via asymmetric modification of miRNA-3p/5p duplex

Project description:Arabidopsis uridylyltransferase on unmethylated sRNAs and directed their degradation. Here, the small RNA deep sequencing of the uridylyltransferase mutants of Arabidopsis were performed, which include Col-0, heso1-1, urt1-1, ntp4-1.

2020-05-23 | GSE151036 | GEO

miR-493-5p, miR-3662, miR-589-3p, human A549 cells, LC-MSMS

Project description:miR-493-5p, miR-3662, and miR-589-3p were estimated as working microRNAs in bleomycin- and methotrexate-induced phenotypic changes in A549 cells via microRNAs-Proteins Analysis of Integrative Relationship (miR-PAIR). To verify the effect of these miRNAs on the their target protein expression levels, comprehensive expression of proteins in A549 cells treated with miR-493-59, miR-3662, and miR-589-3p mimic was examined by SWATH-MS method. As expected by a miR-PAIR mehtod, almost target proteins were succesfully regulated by miR-493-5p and miR-589-3p mimics.

2025-07-25 | PXD053397 | Pride

PETACC-8 miR-31-3p and miR-31-5p Ancillary Study

Project description:This is a prospective-retrospective study to determine if the expression of the miRNA’s miR-31-3p and miR-31-5p are prognostic of patient outcomes or predictive of the benefit from anti-EGFR therapy in stage III Colon Cancer. The present study will utilize FFPE tumor samples collected from patients enrolled in the PETACC-8 study conducted by the Fédération Francophone de Cancérologie Digestive (FFCD). This phase 3 clinical trial prospectively randomized fully resected stage III colon cancer patients to receive adjuvant treatment with either FOLFOX-4 plus cetuximab or FLOFOX-4 alone.

| 2260465 | ecrin-mdr-crc

miR-1307-5p counteracts breast cancer angiogenesis and metastasis

Project description:MiRNAs have been shown to alter both protein expression and secretion in different cellular contexts. By combining in vitro, in vivo and in silico techniques, we demonstrated that overexpression of pre-miR-1307 reduced the ability of breast cancer cells to induce endothelial cell sprouting and angiogenesis. However, the molecular mechanism behind this and the effect of the individual mature miRNAs derived from pre-miR-1307 on protein secretion and is largely unknown. Here, we overexpressed miR-1307-3p|0, -3p|1 and 5p|0 in MDA-MB-231 breast cancer cells and assessed the impact of miRNA overexpression on protein secretion by Mass Spectrometry. Unsupervised hierarchical clustering revealed a distinct phenotype induced by overexpression of miR-1307-5p|0 compared to the controls and to the 5’isomiRs derived from the 3p-arm. Together, our results suggest different impacts of miR-1307-3p and miR-1307-5p on protein secretion which is in line with our in vitro observation that miR-1307-5p, but not the isomiRs derived from the 3p-arm reduce endothelial cell sprouting in vitro. Hence these data support the hypothesis that miR-1307-5p is at least partly responsible for impaired vasculature in tumors overexpressing pre-miR-1307.

2024-12-11 | PXD041087 | Pride

Gene expression analysis of THP-1 cells (monocytic cell line) transfected with microRNA mimics: let-7d-3p, let-7e-5p,miR-146a-5p,miR-130a-3p, miR-151a-3p.

Project description:In our previous study, hsa-let-7d-3p, hsa-let-7e-5p,hsa-miR-146a-5p,hsa-miR-130a-3p, hsa-miR-151a-3p,were significantly upregulated in the plasma of atopic patients. To study the each function of let-7d-3p, let-7e-5p,miR-146a-5p,miR-130a-3p, miR-151a-3p which are significantly upregulated in the plasma of atopic patients, we performed mimic-transfected THP-1 cells, a mononuclear cell line, and performed comprehensive genetic analysis.

2023-02-06 | GSE217971 | GEO

Impact of miR-199-5p, miR-199a-3p and miR-214-3p overexpression on human lung fibroblasts

Project description:To identify putative novel specific targets of miR-199-5p, miR-199a-3p and miR-214-3p, we overexpressed these miRNAs in human MRC5 pulmonary fibroblasts (CCL-171) using synthetic pre-miRNAs or a synthetic “negative” pre-miRNA control (miR-Neg). RNA samples were harvested 48 hours post-transfection and 3 independent experiments were carried out.

2019-04-11 | GSE97824 | GEO

Transcriptome wide target profiling for miR-199a-5p and miR-424-3p.

Project description:Whole transcriptome Identification of direct targets of miR-199a-5p and miR-424-3p using biotinylated pull-downs found that both miRNAs are likely to have a role in the cell cycle. HEK293T cells were transfected with biotinylated miRNAs (either miR-199a-5p or miR-424-3p). The miRNAs and target mRNA were pulled down with streptavidin and compared to the input control.

2013-12-02 | E-GEOD-40406 | biostudies-arrayexpress

Manipulation of Mir140 3p and 5p expression

Project description:The goal of this study was to change the stoichiometry of Mir140-3p and Mir140-5p expression, thereby increasing the expression levels of Mir140-5p, and observe the biological effects on skeletal development. This was done by introducing two types of nucleotide changes into the seed regions of Mir140. The first was by changing the initial bases of Mir140-3p from 'TACCACAGGGTAGAACCACGGACAGGGTACTGGAGC' to 'CGCCACAGGGTAGAACCACGGACAGGGTACTGGAGC' lowering the expression levels of Mir140 3p and disrupting its function. The second change to alter Mir140 expression was by changing the Mir140-5p seed region from 'CAGTGGTTTTACCCTATGGAGG' to 'TAGTGGTTTTACCCTATGGAGG' increasing mi140-5p's ability to be bound by Argonaute.

2020-11-28 | GSE162266 | GEO

Analysis of gene expression in lung adenocarcinoma cells following over-expression of miR-30a-5p or miR-30a-3p

Project description:RNA-sequencing was performed to gain insight into the transcriptome-wide molecular changes induced by miR-30a-5p or miR-30a-3p over-expression in lung adenocarcinoma cells. Following transfection of miR-30a-5p or miR-30a-3p miRNA mimic or control RNA, RNA-sequencing was performed. This high-throughput data revealed elevated expression of both miR-30a-5p and miR-30a-3p reduced the expression of genes and pathways known to induce proliferation and movement in lung adenocarcinoma cells.

2020-02-26 | GSE142695 | GEO

RNAi knock down of miR-30a-3p in human HepG2 cells to identify the target transcripts against miR-30a-3p in vivo

Project description:Human miR-30a-3p was knocked-down in HepG2 using siRNA duplex against the miRNA precursor, and compared to control cells on GeneChip to identify the target transcripts against miR-30a-3p in vivo.

2006-01-01 | E-MEXP-456 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data