Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Variable region V4 of 16S rRNA gene amplified using 515F and 806R primers (Caporaso et al., 2011)

PROVIDER: PRJNA649411 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR12398872.fastq.gz	Fastqsanger.gz

Items per page:

1 - 1 of 1

Similar Datasets

Comparison of arf2, gnc gnl and arf2 gnc gnl transcriptomes

Project description:We have used Agilent whole genome arrays (v4) to compare the gene expression changes between 10-day-old Arabidopsis wild type seedlings and arf2-8 (Ellis et al., 2005), gnc gnl (Richter et al., 2011) and arf2 gnc gnl mutants (all Col ecotype).

2013-07-15 | GSE35730 | GEO

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

2013-06-25 | E-GEOD-42426 | biostudies-arrayexpress

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Comparison of arf2, gnc gnl and arf2 gnc gnl transcriptomes

2013-07-15 | E-GEOD-35730 | biostudies-arrayexpress

Uppsala_18S_amplicons

Project description:V4 region amplified with universal 18S primers from ten different samples taken around Uppsala, Sweden.

| PRJEB23666 | ENA

Strand-oriented RNAseq of LNCaP prostate cancer cells in culture for 24h in the presence of androgen

Project description:The aim of this study was to use NGS RNAseq deep-sequencing in order to characterize the polyadenylated mRNAs and lncRNAs expressed in LNCaP cells treated with androgen hormone compared with untreated LNCaP cells (GSE79301). Trimmed reads were mapped using the hg19 genome with TopHat v.2.0.12 and Bowtie v.2.2.3. The assembly was guided by a custom GTF file created with transcripts fromhuman lncRNA annotations from GENCODE v19 (Harrow, Frankish et al.2012) and those already annotated as lincRNAs in (Cabili, Trapnell et al. 2011; Prensner, Iyer et al. 2011; Hangauer, Vaughn et al. 2013). The diferencial expression was calculated by the sum of exon read count per gene with HTSeq (Anders, Pyl et al. 2015), followed by a DESeq2 analysis (Love, Huber et al. 2014).

2017-12-31 | GSE102305 | GEO

A time-course profiling of the effects of maslinic acid on mRNA expression of chemically induced Raji cells.

Project description:Maslinic acid is a novel phytochemical reported to exert prominent anti-cancer effects and it was hypothesized that this compound induces cellular apoptosis through the activation of the mitochondrial apoptotic pathway (Martin et al, 2007) — thereby resulting in significant inhibition of cell proliferation in a dose-dependent manner (Reyes-Zurita et al, 2009). Prior studies on maslinic acid in its function as a time-dependent inhibitor in both tumorigenesis and inflammation events by targeting multiple signaling pathways; particularly the NF-ĸB, MAPK (Li et al, 2010; Yap, et al, 2011) and JNK (Reyes-Zurita et al, 2011) pathways were mostly based on proteomic analyses (Li et al, 2010; Yap et. al., 2011). However, these results may not depict an accurate scenario of the signaling networks involved due to protein degradation, alternate splicing and extensive post-translational processing. Hence, this study aimed to construct a temporal-based global gene expression profile of the effects of maslinic acid by using the microarray technology. The aim of this project is to construct the complete global mRNA profile of the effects of maslinic acid in inhibiting early-antigen formation in Raji cells.

2018-05-02 | GSE39149 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data