An engineered decoy receptor for SARS-CoV-2 broadly binds protein S sequence variants
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA668631 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR12808103_1.fastq.gz | Fastqsanger.gz | |||
| SRR12808103_2.fastq.gz | Fastqsanger.gz | |||
| SRR12808104_1.fastq.gz | Fastqsanger.gz | |||
| SRR12808104_2.fastq.gz | Fastqsanger.gz | |||
| SRR12808105_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 14 |
Similar Datasets
Project description:The spike S of SARS-CoV-2 recognizes ACE2 on the host cell membrane to initiate entry. Soluble decoy receptors, in which the ACE2 ectodomain is engineered to block S with high affinity, potently neutralize infection and, due to close similarity with the natural receptor, hold out the promise of being broadly active against virus variants without opportunity for escape. Here, we directly test this hypothesis. Using deep mutagenesis, we find that the ACE2-binding surface of the SARS-CoV-2 spike tolerates high mutational diversity, which may act as a source for resistance to therapeutics. However, saturation mutagenesis of the receptor-binding domain (RBD) followed by in vitro selection, with wild type ACE2 and the engineered decoy competing for binding sites, failed to find S mutants that discriminate in favor of the wild type receptor. We conclude that resistance to engineered decoys will be rare.
2020-10-18 | GSE159372 | GEO
Project description:The spike S of SARS-CoV-2 recognizes ACE2 on the host cell membrane to initiate entry. Soluble decoy receptors, in which the ACE2 ectodomain is engineered to block S with high affinity, potently neutralize infection and, because of close similarity with the natural receptor, hold out the promise of being broadly active against virus variants without opportunity for escape. Here, we directly test this hypothesis. We find that an engineered decoy receptor, sACE22v2.4, tightly binds S of SARS-associated viruses from humans and bats, despite the ACE2-binding surface being a region of high diversity. Saturation mutagenesis of the receptor-binding domain followed by in vitro selection, with wild-type ACE2 and the engineered decoy competing for binding sites, failed to find S mutants that discriminate in favor of the wild-type receptor. We conclude that resistance to engineered decoys will be rare and that decoys may be active against future outbreaks of SARS-associated betacoronaviruses.
| S-EPMC7888922 | biostudies-literature
Project description:The spike S of SARS-CoV-2 recognizes ACE2 on the host cell membrane to initiate entry. Soluble decoy receptors, in which the ACE2 ectodomain is engineered to block S with high affinity, potently neutralize infection and, due to close similarity with the natural receptor, hold out the promise of being broadly active against virus variants without opportunity for escape. Here, we directly test this hypothesis. We find an engineered decoy receptor, sACE2 2 .v2.4, tightly binds S of SARS-associated viruses from humans and bats, despite the ACE2-binding surface being a region of high diversity. Saturation mutagenesis of the receptor-binding domain (RBD) followed by in vitro selection, with wild type ACE2 and the engineered decoy competing for binding sites, failed to find S mutants that discriminate in favor of the wild type receptor. Variant N501Y in the RBD, which has emerged in a rapidly spreading lineage (B.1.1.7) in England, enhances affinity for wild type ACE2 20-fold but remains tightly bound to engineered sACE22.v2.4. We conclude that resistance to engineered decoys will be rare and that decoys may be active against future outbreaks of SARS-associated betacoronaviruses.
| S-EPMC7781310 | biostudies-literature
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:The COVID-19 pandemic continues to be a severe threat to human health, especially due to current and emerging SARS-CoV-2 variants with potential to escape humoral immunity developed after vaccination or infection. The development of broadly neutralizing antibodies that engage evolutionarily conserved epitopes on coronavirus spike proteins represents a promising strategy to improve therapy and prophylaxis against SARS-CoV-2 and variants thereof. Herein, a facile multivalent engineering approach is employed to achieve large synergistic improvements in the neutralizing activity of a SARS-CoV-2 cross-reactive nanobody (VHH-72) initially generated against SARS-CoV. This synergy is epitope specific and is not observed for a second high-affinity nanobody against a non-conserved epitope in the receptor-binding domain. Importantly, a hexavalent VHH-72 nanobody retains binding to spike proteins from multiple highly transmissible SARS-CoV-2 variants (B.1.1.7 and B.1.351) and potently neutralizes them. Multivalent VHH-72 nanobodies also display drug-like biophysical properties, including high stability, high solubility, and low levels of non-specific binding. The unique neutralizing and biophysical properties of VHH-72 multivalent nanobodies make them attractive as therapeutics against SARS-CoV-2 variants.
| S-EPMC8420545 | biostudies-literature
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Vaccine hesitancy and emergence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants of concern (VOCs) escaping vaccine-induced immune responses highlight the urgency for new COVID-19 therapeutics. Engineered angiotensin-converting enzyme 2 (ACE2) proteins with augmented binding affinities for SARS-CoV-2 spike (S) protein may prove to be especially efficacious against multiple variants. Using molecular dynamics simulations and functional assays, we show that three amino acid substitutions in an engineered soluble ACE2 protein markedly augmented the affinity for the S protein of the SARS-CoV-2 WA-1/2020 isolate and multiple VOCs: B.1.1.7 (Alpha), B.1.351 (Beta), P.1 (Gamma) and B.1.617.2 (Delta). In humanized K18-hACE2 mice infected with the SARS-CoV-2 WA-1/2020 or P.1 variant, prophylactic and therapeutic injections of soluble ACE22.v2.4-IgG1 prevented lung vascular injury and edema formation, essential features of CoV-2-induced SARS, and above all improved survival. These studies demonstrate broad efficacy in vivo of an engineered ACE2 decoy against SARS-CoV-2 variants in mice and point to its therapeutic potential.
| S-EPMC8885411 | biostudies-literature
Project description:Arabidopsis thaliana DECOY, At1g14620/T5E21_15 [Source:UniProtKB/TrEMBL;Acc:Q8L7U3], is differentially expressed in 84 experiment(s);
| AT1G14620 | ExpressionAtlas
Project description:Arabidopsis thaliana DECOY, At1g14620/T5E21_15 [Source:UniProtKB/TrEMBL;Acc:Q8L7U3], is expressed in 16 baseline experiment(s);
| AT1G14620 | ExpressionAtlas
Project description:MicroRNA-10b may target numerous genes in gliomagenesis. The target genes of miR-10b may differ according to the cellular context. We used microarray analyses to determine the phenotypic effects and gene targets of miR-10b by silencing miR-10b in invasive U87-2M1 glioma cells. Early passage U87-2M1 cells treated with the baculoviral control decoy vector or miR-10b decoy vector were selected for RNA extraction and hybridization on microarray
2012-12-31 | E-GEOD-35170 | biostudies-arrayexpress